Mutagenetix > Incidental Mutation

Incidental Mutation 'R7699:Arhgef5'

593848

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7699 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43274757 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 814 (I814T)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably benign
Transcript: ENSMUST00000031750
AA Change: I814T

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: I814T

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810009A15Rik	T	C	19: 8,890,053	L72P	probably benign	Het
4930407I10Rik	C	A	15: 82,064,105	H734Q	probably benign	Het
4932438A13Rik	T	A	3: 36,974,172	N2329K	possibly damaging	Het
4932438A13Rik	C	T	3: 37,026,154	S267L	probably benign	Het
Acadl	A	G	1: 66,838,363	V343A	possibly damaging	Het
Acot4	A	T	12: 84,043,237	D236V	probably damaging	Het
App	T	A	16: 85,040,309		probably null	Het
Arfgef1	G	A	1: 10,194,411	T470I	possibly damaging	Het
Atr	A	T	9: 95,875,690	R968*	probably null	Het
C130060K24Rik	T	A	6: 65,452,956	I212N	probably benign	Het
Capn7	C	T	14: 31,352,444	T268I	probably benign	Het
Cbwd1	A	G	19: 24,942,681		probably null	Het
Cubn	A	T	2: 13,348,178	F1916L	probably benign	Het
Cubn	A	G	2: 13,489,917	V107A	possibly damaging	Het
Cyp11b1	T	A	15: 74,835,842	T473S	probably damaging	Het
Cyr61	C	T	3: 145,648,692	G155R	probably damaging	Het
Dip2c	T	G	13: 9,659,311	S1396A	probably benign	Het
Dyrk1b	T	C	7: 28,184,312	Y198H	probably damaging	Het
Echdc2	G	T	4: 108,174,077	R206L	probably benign	Het
Ep400	C	T	5: 110,696,032	R1594Q	unknown	Het
Fmnl2	G	A	2: 53,036,508	R69Q		Het
Fry	T	A	5: 150,405,327	H1308Q	probably damaging	Het
Fyb2	T	A	4: 105,010,454	D667E	probably benign	Het
Gimap7	T	A	6: 48,723,857	Y126N	possibly damaging	Het
Gm1979	A	T	5: 26,000,180	W266R	probably damaging	Het
Gm28042	T	A	2: 120,039,716	M712K	possibly damaging	Het
Gm3238	A	G	10: 77,770,635	*231R	probably null	Het
Gm5592	C	A	7: 41,286,407	A111E	probably damaging	Het
Gm7694	A	G	1: 170,301,148	*271Q	probably null	Het
Ift81	T	C	5: 122,594,560	M304V	possibly damaging	Het
Igfals	T	C	17: 24,880,574	L213P	probably damaging	Het
Ints3	G	A	3: 90,421,804	P83S	probably benign	Het
Kcna10	T	G	3: 107,195,540	S496A	probably damaging	Het
Kmt2d	G	A	15: 98,843,719	A4520V	unknown	Het
Lemd3	A	T	10: 120,978,090	Y413N	probably damaging	Het
Lgr6	T	C	1: 134,996,032	N453S	probably damaging	Het
Lmtk3	A	C	7: 45,792,574	D352A	probably damaging	Het
Lrrc4c	T	C	2: 97,630,679	M550T	possibly damaging	Het
Maml2	A	T	9: 13,621,089	Q533L		Het
Mdn1	T	A	4: 32,741,344	D3815E	probably damaging	Het
Megf8	C	T	7: 25,329,928	A299V	possibly damaging	Het
Meis3	G	T	7: 16,177,556	E59D	probably benign	Het
Mppe1	A	G	18: 67,225,704	*398R	probably null	Het
Mtmr7	G	A	8: 40,606,884	A62V	possibly damaging	Het
Mtus1	T	A	8: 41,083,969	T237S	possibly damaging	Het
Ndfip2	T	A	14: 105,287,759	V158E	possibly damaging	Het
Nrbp2	T	G	15: 76,090,897	T53P	probably damaging	Het
Nrde2	G	A	12: 100,130,835	P902L	probably benign	Het
Olfr1383	A	G	11: 49,524,554	Y277C	probably damaging	Het
Olfr509	T	A	7: 108,645,672	K301N	probably damaging	Het
Olfr642	T	A	7: 104,050,593		probably benign	Het
Olfr739	T	A	14: 50,425,335	M272K	probably benign	Het
Olfr771	T	C	10: 129,160,055	M310V	probably benign	Het
Pcdha1	A	G	18: 36,931,062	T260A	probably damaging	Het
Pdlim1	T	G	19: 40,249,658	K98N	probably damaging	Het
Phrf1	G	A	7: 141,254,929	G207R	unknown	Het
Pik3r6	A	G	11: 68,528,563	K124R	probably damaging	Het
Polr2b	T	A	5: 77,340,421	F823I	probably benign	Het
Prss58	T	C	6: 40,895,388	I234V	probably damaging	Het
Ptpn14	A	T	1: 189,865,411	N766I	probably benign	Het
Repin1	T	A	6: 48,597,822	S562T	probably damaging	Het
Rgr	C	T	14: 37,044,595	D165N	probably damaging	Het
Rho	T	C	6: 115,935,239	F221L	probably damaging	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Rnase2a	A	G	14: 51,255,791	I39T	probably damaging	Het
Rpl13a	T	G	7: 45,127,236	I43L	probably benign	Het
Rpp30	T	C	19: 36,089,158	V97A	probably benign	Het
Scube3	T	C	17: 28,167,049	Y755H	probably damaging	Het
Sec24a	A	T	11: 51,712,257	V788E	probably damaging	Het
Spns2	A	T	11: 72,489,617	L60*	probably null	Het
Strc	T	C	2: 121,371,748	N1213S	possibly damaging	Het
Tec	A	T	5: 72,786,024	I116N	possibly damaging	Het
Tll1	A	T	8: 64,093,954	D319E	probably benign	Het
Tmem121b	T	C	6: 120,493,427	T110A	unknown	Het
Tmem232	T	A	17: 65,265,218	I593F	probably damaging	Het
Tpp2	A	G	1: 43,970,466	I487V	probably benign	Het
Ubr4	C	A	4: 139,408,867	C934*	probably null	Het
Vmn1r68	A	G	7: 10,527,632	Y180H	probably benign	Het
Vmn2r25	T	C	6: 123,839,923	D233G	possibly damaging	Het
Wdr6	A	G	9: 108,576,361	W108R	possibly damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCTCCACTGACCCTAAGTTCAG -3'
(R):5'- AGAGAGTAGAAGCTGTCCAGTC -3'

Sequencing Primer
(F):5'- GGGCTCCATAGATCTTCTAAAGGC -3'
(R):5'- AAGCTGTCCAGTCTTGATTATTAGG -3'

Posted On

2019-11-12