Incidental Mutation 'R7715:Lrrc17'
ID594837
Institutional Source Beutler Lab
Gene Symbol Lrrc17
Ensembl Gene ENSMUSG00000039883
Gene Nameleucine rich repeat containing 17
Synonyms6130400C22Rik, 37kDa, 4833425M04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7715 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location21543559-21575904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21561080 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 187 (N187Y)
Ref Sequence ENSEMBL: ENSMUSP00000038569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035651] [ENSMUST00000051358] [ENSMUST00000115234]
Predicted Effect probably damaging
Transcript: ENSMUST00000035651
AA Change: N187Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038569
Gene: ENSMUSG00000039883
AA Change: N187Y

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Blast:LRR 83 105 8e-6 BLAST
LRR 106 129 9.96e-1 SMART
LRR 130 153 1.07e0 SMART
LRRCT 165 215 8.98e-4 SMART
LRR 270 292 8.73e1 SMART
LRR 293 316 3.52e-1 SMART
LRR 317 340 7.55e-1 SMART
LRRCT 352 403 8.95e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051358
SMART Domains Protein: ENSMUSP00000052716
Gene: ENSMUSG00000048520

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 425 4.51e2 SMART
LRR 426 451 2.63e0 SMART
LRR 476 501 4.15e1 SMART
LRR 502 526 1.82e1 SMART
LRR 529 554 1.76e-1 SMART
LRR_CC 555 580 4.61e-5 SMART
LRR 604 629 8.81e-2 SMART
LRR 630 655 2.37e1 SMART
LRR 656 681 3.21e-4 SMART
LRR 682 707 6.57e-1 SMART
LRR 708 733 9.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115234
SMART Domains Protein: ENSMUSP00000110889
Gene: ENSMUSG00000048520

DomainStartEndE-ValueType
low complexity region 160 173 N/A INTRINSIC
FBOX 243 283 3.73e-4 SMART
LRR_CC 328 353 6.62e-6 SMART
LRR 354 378 3.67e2 SMART
LRR 379 404 2.75e-3 SMART
LRR 407 432 6.88e-4 SMART
Blast:LRR 433 458 7e-8 BLAST
LRR 459 484 2.63e0 SMART
LRR 509 534 4.15e1 SMART
LRR 535 559 1.82e1 SMART
LRR 562 587 1.76e-1 SMART
LRR_CC 588 613 4.61e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137788
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,500 F57L probably benign Het
Agl C T 3: 116,758,256 R563Q Het
Ahctf1 A G 1: 179,770,848 M919T probably benign Het
Ano4 A T 10: 88,995,311 N483K probably damaging Het
Armt1 A G 10: 4,450,751 K166R probably benign Het
Asgr2 T C 11: 70,096,895 V73A probably benign Het
Atp6v0a2 A C 5: 124,714,198 T564P probably damaging Het
B3gntl1 T C 11: 121,639,796 T150A possibly damaging Het
Bach1 A G 16: 87,719,971 I467V possibly damaging Het
Bicd1 A G 6: 149,512,973 K395E probably benign Het
C330027C09Rik A T 16: 49,013,984 Q643L probably damaging Het
Cadps G A 14: 12,457,762 P1040S probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Canx A G 11: 50,310,804 S80P probably benign Het
Ccdc149 T A 5: 52,404,191 probably null Het
Cd34 A T 1: 194,949,316 N87Y probably damaging Het
Cdh11 T A 8: 102,664,714 I297F possibly damaging Het
Col14a1 A G 15: 55,487,983 I1569V unknown Het
Cxcr4 C T 1: 128,589,742 V61M probably damaging Het
Cyp20a1 G A 1: 60,372,605 V271M probably benign Het
Cyp2b23 T C 7: 26,681,695 Y79C probably benign Het
Daam1 A G 12: 71,988,901 K957E probably benign Het
Dip2c A G 13: 9,614,391 K947E probably damaging Het
Efcab12 T C 6: 115,823,543 K173R possibly damaging Het
Emc1 C T 4: 139,371,623 R806C probably damaging Het
Epg5 G A 18: 77,968,586 R816Q probably damaging Het
Faf1 G T 4: 109,710,814 D24Y probably damaging Het
Fchsd1 A T 18: 37,966,642 probably null Het
Foxp1 T C 6: 98,945,660 T404A unknown Het
Fra10ac1 T C 19: 38,189,838 E299G probably damaging Het
Gon4l A G 3: 88,908,006 T1959A probably benign Het
Gpam A C 19: 55,088,921 V146G probably benign Het
Hephl1 T A 9: 15,060,785 D953V probably benign Het
Kcnc2 G T 10: 112,271,940 E79* probably null Het
Kcnj12 T A 11: 61,066,952 probably null Het
Llgl2 A T 11: 115,849,728 T417S probably benign Het
Macc1 C T 12: 119,446,256 A253V possibly damaging Het
Mark1 A G 1: 184,907,234 S529P probably damaging Het
Mfsd6l T C 11: 68,557,550 L409P probably damaging Het
Nek1 A G 8: 61,006,760 E34G probably damaging Het
Nlrp3 T A 11: 59,543,003 probably null Het
Obsl1 A T 1: 75,502,036 V686D probably damaging Het
Olfr1537 A T 9: 39,237,878 L182H probably damaging Het
Olfr167 C T 16: 19,514,730 R302K probably benign Het
Olfr545 T A 7: 102,494,461 M105L possibly damaging Het
Olfr871 G A 9: 20,212,435 G29R probably damaging Het
Olfr871 G A 9: 20,212,436 G29E probably benign Het
Olfr893 T A 9: 38,209,479 M140K probably benign Het
Ostm1 G A 10: 42,683,187 G148R probably benign Het
Oxsr1 A G 9: 119,242,756 S470P probably damaging Het
Pacs1 C T 19: 5,141,681 M709I probably benign Het
Pan2 A G 10: 128,317,723 M963V probably benign Het
Pds5a A G 5: 65,638,561 L662P possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sh2b2 T C 5: 136,219,035 N554S probably benign Het
Sh3gl2 T A 4: 85,398,840 probably null Het
Slc24a4 A G 12: 102,218,960 M93V possibly damaging Het
Sohlh1 A G 2: 25,844,628 S218P possibly damaging Het
Spast T A 17: 74,368,926 N321K probably benign Het
Srcap T G 7: 127,549,288 I1936S probably damaging Het
Themis G A 10: 28,863,309 V592I probably benign Het
Tnfrsf1a C T 6: 125,361,414 T296I possibly damaging Het
Ttk A G 9: 83,865,153 T682A probably benign Het
Virma C T 4: 11,549,682 R1807W probably damaging Het
Virma A G 4: 11,513,016 probably null Het
Vmn2r101 T A 17: 19,611,915 D724E probably damaging Het
Vmn2r11 A G 5: 109,047,441 V673A probably damaging Het
Wbp4 C T 14: 79,466,294 S271N probably benign Het
Wdr66 A G 5: 123,262,134 N439D probably damaging Het
Other mutations in Lrrc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Lrrc17 APN 5 21575271 missense probably benign 0.05
IGL01289:Lrrc17 APN 5 21560901 missense probably damaging 1.00
IGL01549:Lrrc17 APN 5 21570290 missense probably benign 0.00
IGL02105:Lrrc17 APN 5 21570257 missense probably benign 0.30
IGL02371:Lrrc17 APN 5 21560996 missense probably damaging 1.00
IGL02412:Lrrc17 APN 5 21560879 missense possibly damaging 0.68
IGL02587:Lrrc17 APN 5 21561080 missense probably damaging 1.00
R0255:Lrrc17 UTSW 5 21560969 missense probably benign 0.09
R0504:Lrrc17 UTSW 5 21560530 missense probably benign 0.05
R0883:Lrrc17 UTSW 5 21561278 missense probably benign 0.06
R1875:Lrrc17 UTSW 5 21560652 missense possibly damaging 0.85
R2168:Lrrc17 UTSW 5 21575048 missense probably damaging 0.97
R5057:Lrrc17 UTSW 5 21575309 missense probably benign 0.25
R5326:Lrrc17 UTSW 5 21575158 missense probably damaging 0.99
R5542:Lrrc17 UTSW 5 21575158 missense probably damaging 0.99
R5574:Lrrc17 UTSW 5 21570357 missense possibly damaging 0.90
R5872:Lrrc17 UTSW 5 21575266 missense probably benign 0.01
R7108:Lrrc17 UTSW 5 21575339 missense possibly damaging 0.93
R7766:Lrrc17 UTSW 5 21561044 missense probably benign 0.03
R8079:Lrrc17 UTSW 5 21561071 missense probably damaging 0.99
R8121:Lrrc17 UTSW 5 21570331 missense probably benign 0.00
X0026:Lrrc17 UTSW 5 21561020 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGATCTCCAAAATTGAGAGCG -3'
(R):5'- GGGAAACACGTAATTGTGGCAC -3'

Sequencing Primer
(F):5'- AAAATTGAGAGCGAGGCGTTCTTTG -3'
(R):5'- CACAGAGTGGAGTCTGCTTC -3'
Posted On2019-11-12