Incidental Mutation 'R7721:Mob4'
ID595205
Institutional Source Beutler Lab
Gene Symbol Mob4
Ensembl Gene ENSMUSG00000025979
Gene NameMOB family member 4, phocein
SynonymsMobkl3, Prei3
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R7721 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location55131231-55154899 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 55148320 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 76 (Q76*)
Ref Sequence ENSEMBL: ENSMUSP00000125415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027122] [ENSMUST00000159311] [ENSMUST00000161122] [ENSMUST00000162364] [ENSMUST00000162553]
Predicted Effect probably benign
Transcript: ENSMUST00000027122
SMART Domains Protein: ENSMUSP00000027122
Gene: ENSMUSG00000025979

DomainStartEndE-ValueType
Pfam:Mob1_phocein 28 168 1.2e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159311
AA Change: Q55*
SMART Domains Protein: ENSMUSP00000124790
Gene: ENSMUSG00000025979
AA Change: Q55*

DomainStartEndE-ValueType
Pfam:Mob1_phocein 19 189 9.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161122
AA Change: A42V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably null
Transcript: ENSMUST00000162364
AA Change: Q76*
SMART Domains Protein: ENSMUSP00000125415
Gene: ENSMUSG00000025979
AA Change: Q76*

DomainStartEndE-ValueType
Mob1_phocein 42 209 1.89e-58 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162553
AA Change: Q44*
SMART Domains Protein: ENSMUSP00000124151
Gene: ENSMUSG00000025979
AA Change: Q44*

DomainStartEndE-ValueType
Pfam:Mob1_phocein 8 178 3.9e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on its similarity with the mouse counterpart. Studies of the mouse counterpart suggest that the expression of this gene may be regulated during oocyte maturation and preimplantation following zygotic gene activation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HSPE1.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik T A 11: 69,121,526 T9S unknown Het
A630095E13Rik C T 9: 36,637,863 G34R possibly damaging Het
Adamtsl3 T G 7: 82,606,520 M1580R possibly damaging Het
Alg9 T C 9: 50,776,642 I78T probably damaging Het
Ankrd11 G T 8: 122,894,759 L785M probably damaging Het
Atrnl1 T A 19: 57,696,331 D796E probably benign Het
C1s2 A G 6: 124,630,058 V277A possibly damaging Het
Cldn15 A G 5: 136,968,161 M19V probably benign Het
Cldn23 T G 8: 35,826,263 S24R possibly damaging Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Csf2ra A T 19: 61,226,586 W147R probably damaging Het
Ctsb G T 14: 63,133,316 probably benign Het
D430041D05Rik A G 2: 104,258,529 M34T probably benign Het
Dmtf1 T C 5: 9,126,564 I463V probably damaging Het
Dnah7a T A 1: 53,631,683 D470V probably benign Het
Dtx4 A G 19: 12,482,136 S435P probably benign Het
Ear2 T A 14: 44,103,038 M51K probably damaging Het
Faf1 T A 4: 109,736,597 I124N probably damaging Het
Gkap1 A C 13: 58,236,985 probably null Het
Glipr2 T C 4: 43,957,770 S4P probably benign Het
Gm11639 T A 11: 104,724,540 L711* probably null Het
Gm38119 A T 3: 92,738,030 C86S unknown Het
Gm6583 A G 5: 112,355,517 I107T probably benign Het
Gpr171 T G 3: 59,097,899 I152L probably benign Het
Homer3 T C 8: 70,291,012 V180A probably benign Het
Irx1 T A 13: 71,960,057 M169L probably benign Het
Kap A G 6: 133,851,727 probably null Het
Lyzl4 GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG 9: 121,583,989 probably null Het
Mgat5b A G 11: 116,966,801 M2V Het
Olfr1493-ps1 T A 19: 13,726,843 I194N possibly damaging Het
Olfr911-ps1 A T 9: 38,523,717 probably null Het
Olfr943 A G 9: 39,184,760 D191G probably benign Het
Pcdha9 A T 18: 36,999,636 Q586L probably benign Het
Pgk2 T A 17: 40,207,518 I340F probably benign Het
Prex1 G A 2: 166,577,890 Q1289* probably null Het
Prr22 A G 17: 56,771,819 D324G possibly damaging Het
Rab2b A T 14: 52,263,760 S201T probably benign Het
Rdh1 T A 10: 127,760,252 probably null Het
Rhbdl1 G T 17: 25,836,149 N82K probably benign Het
Rspo1 C A 4: 124,991,417 Q29K possibly damaging Het
Rtp3 A T 9: 110,985,880 Y472* probably null Het
Senp5 T A 16: 31,990,434 M1L unknown Het
Stab1 A G 14: 31,141,456 V2091A possibly damaging Het
Stk32c A G 7: 139,188,153 S71P possibly damaging Het
Tpr A G 1: 150,444,429 T2243A probably benign Het
Tubgcp6 A T 15: 89,101,401 N1544K probably damaging Het
Uqcc1 T C 2: 155,858,146 N202S probably benign Het
Vmn2r18 C T 5: 151,586,693 E72K possibly damaging Het
Zfp654 C A 16: 64,786,207 C3F probably damaging Het
Zfp804b T C 5: 6,771,263 E600G possibly damaging Het
Other mutations in Mob4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03340:Mob4 APN 1 55136708 missense possibly damaging 0.50
R4756:Mob4 UTSW 1 55152696 missense probably damaging 0.98
R4831:Mob4 UTSW 1 55152740 missense probably benign 0.01
R4832:Mob4 UTSW 1 55145252 intron probably benign
R4876:Mob4 UTSW 1 55152836 unclassified probably benign
R4972:Mob4 UTSW 1 55151002 missense possibly damaging 0.96
R5747:Mob4 UTSW 1 55148578 missense probably damaging 1.00
R6717:Mob4 UTSW 1 55136713 missense possibly damaging 0.91
R6774:Mob4 UTSW 1 55148429 intron probably null
R6925:Mob4 UTSW 1 55152722 nonsense probably null
R7447:Mob4 UTSW 1 55131466 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACACGGTTAATGTGAACACCTTTG -3'
(R):5'- TATCTGGATGGCATTCACTCTG -3'

Sequencing Primer
(F):5'- TGTGAACACCTTTGTAACATAACTG -3'
(R):5'- ACACTGGAAAAATCTAAGCATA -3'
Posted On2019-11-12