Incidental Mutation 'R7721:Adamtsl3'
ID595223
Institutional Source Beutler Lab
Gene Symbol Adamtsl3
Ensembl Gene ENSMUSG00000070469
Gene NameADAMTS-like 3
Synonymspunctin-2, 9230119C12Rik
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7721 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location82335694-82614450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 82606520 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1580 (M1580R)
Ref Sequence ENSEMBL: ENSMUSP00000133637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173287] [ENSMUST00000173828]
Predicted Effect possibly damaging
Transcript: ENSMUST00000173287
AA Change: M1580R

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133637
Gene: ENSMUSG00000070469
AA Change: M1580R

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TSP1 90 136 6.43e-8 SMART
TSP1 355 414 1.59e-1 SMART
TSP1 433 492 3.72e-4 SMART
TSP1 494 547 4.28e-4 SMART
TSP1 579 638 1.85e-2 SMART
TSP1 660 717 1.75e-2 SMART
TSP1 719 773 3.45e-8 SMART
TSP1 775 833 3.67e-3 SMART
TSP1 836 894 8.99e-2 SMART
IGc2 938 1002 7.59e-4 SMART
IG 1213 1296 4.87e0 SMART
IGc2 1326 1388 1.01e-13 SMART
TSP1 1441 1498 1.95e-2 SMART
TSP1 1500 1559 6.76e-2 SMART
TSP1 1616 1666 3.84e-1 SMART
Pfam:PLAC 1674 1704 2.4e-11 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000133337
Gene: ENSMUSG00000070469
AA Change: M654R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:IG 22 79 1e-26 BLAST
SCOP:d1biha4 27 77 2e-5 SMART
IG 283 366 4.87e0 SMART
IGc2 396 458 1.01e-13 SMART
TSP1 511 568 1.95e-2 SMART
TSP1 570 629 6.76e-2 SMART
TSP1 686 736 3.84e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype Strain: 3605825
Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. (SEE BELOW)
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik T A 11: 69,121,526 T9S unknown Het
A630095E13Rik C T 9: 36,637,863 G34R possibly damaging Het
Alg9 T C 9: 50,776,642 I78T probably damaging Het
Ankrd11 G T 8: 122,894,759 L785M probably damaging Het
Atrnl1 T A 19: 57,696,331 D796E probably benign Het
C1s2 A G 6: 124,630,058 V277A possibly damaging Het
Cldn15 A G 5: 136,968,161 M19V probably benign Het
Cldn23 T G 8: 35,826,263 S24R possibly damaging Het
Cnr1 T A 4: 33,944,416 I268N probably damaging Het
Csf2ra A T 19: 61,226,586 W147R probably damaging Het
Ctsb G T 14: 63,133,316 probably benign Het
D430041D05Rik A G 2: 104,258,529 M34T probably benign Het
Dmtf1 T C 5: 9,126,564 I463V probably damaging Het
Dnah7a T A 1: 53,631,683 D470V probably benign Het
Dtx4 A G 19: 12,482,136 S435P probably benign Het
Ear2 T A 14: 44,103,038 M51K probably damaging Het
Faf1 T A 4: 109,736,597 I124N probably damaging Het
Gkap1 A C 13: 58,236,985 probably null Het
Glipr2 T C 4: 43,957,770 S4P probably benign Het
Gm11639 T A 11: 104,724,540 L711* probably null Het
Gm38119 A T 3: 92,738,030 C86S unknown Het
Gm6583 A G 5: 112,355,517 I107T probably benign Het
Gpr171 T G 3: 59,097,899 I152L probably benign Het
Homer3 T C 8: 70,291,012 V180A probably benign Het
Irx1 T A 13: 71,960,057 M169L probably benign Het
Kap A G 6: 133,851,727 probably null Het
Lyzl4 GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAAGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG GGACACACTGCAGAGGGAGTGGAGAGAAAGGGACCCACCAGTGCAGGACACACTGCAGAGG 9: 121,583,989 probably null Het
Mgat5b A G 11: 116,966,801 M2V Het
Mob4 C T 1: 55,148,320 Q76* probably null Het
Olfr1493-ps1 T A 19: 13,726,843 I194N possibly damaging Het
Olfr911-ps1 A T 9: 38,523,717 probably null Het
Olfr943 A G 9: 39,184,760 D191G probably benign Het
Pcdha9 A T 18: 36,999,636 Q586L probably benign Het
Pgk2 T A 17: 40,207,518 I340F probably benign Het
Prex1 G A 2: 166,577,890 Q1289* probably null Het
Prr22 A G 17: 56,771,819 D324G possibly damaging Het
Rab2b A T 14: 52,263,760 S201T probably benign Het
Rdh1 T A 10: 127,760,252 probably null Het
Rhbdl1 G T 17: 25,836,149 N82K probably benign Het
Rspo1 C A 4: 124,991,417 Q29K possibly damaging Het
Rtp3 A T 9: 110,985,880 Y472* probably null Het
Senp5 T A 16: 31,990,434 M1L unknown Het
Stab1 A G 14: 31,141,456 V2091A possibly damaging Het
Stk32c A G 7: 139,188,153 S71P possibly damaging Het
Tpr A G 1: 150,444,429 T2243A probably benign Het
Tubgcp6 A T 15: 89,101,401 N1544K probably damaging Het
Uqcc1 T C 2: 155,858,146 N202S probably benign Het
Vmn2r18 C T 5: 151,586,693 E72K possibly damaging Het
Zfp654 C A 16: 64,786,207 C3F probably damaging Het
Zfp804b T C 5: 6,771,263 E600G possibly damaging Het
Other mutations in Adamtsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01549:Adamtsl3 APN 7 82612448 missense probably damaging 1.00
IGL01936:Adamtsl3 APN 7 82595371 missense possibly damaging 0.93
IGL02819:Adamtsl3 APN 7 82574121 missense probably damaging 0.99
P0012:Adamtsl3 UTSW 7 82574257 missense probably benign 0.27
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0096:Adamtsl3 UTSW 7 82465699 intron probably benign
R0180:Adamtsl3 UTSW 7 82575990 missense probably benign 0.00
R0270:Adamtsl3 UTSW 7 82556824 missense probably damaging 1.00
R0295:Adamtsl3 UTSW 7 82548005 critical splice donor site probably null
R0329:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0330:Adamtsl3 UTSW 7 82521990 missense probably damaging 1.00
R0548:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R0611:Adamtsl3 UTSW 7 82528912 missense probably damaging 1.00
R0671:Adamtsl3 UTSW 7 82523182 missense probably damaging 1.00
R0711:Adamtsl3 UTSW 7 82465699 intron probably benign
R0845:Adamtsl3 UTSW 7 82575996 missense probably damaging 1.00
R1119:Adamtsl3 UTSW 7 82540317 missense probably damaging 0.96
R1458:Adamtsl3 UTSW 7 82523320 missense probably damaging 1.00
R1644:Adamtsl3 UTSW 7 82450090 missense possibly damaging 0.87
R1691:Adamtsl3 UTSW 7 82499606 missense probably damaging 1.00
R1838:Adamtsl3 UTSW 7 82493373 missense probably damaging 1.00
R2131:Adamtsl3 UTSW 7 82578594 missense probably damaging 1.00
R2245:Adamtsl3 UTSW 7 82450100 missense probably damaging 1.00
R2274:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2275:Adamtsl3 UTSW 7 82606558 missense probably benign 0.37
R2448:Adamtsl3 UTSW 7 82499748 missense probably damaging 1.00
R3725:Adamtsl3 UTSW 7 82612404 missense possibly damaging 0.80
R3757:Adamtsl3 UTSW 7 82337207 missense probably benign 0.01
R3821:Adamtsl3 UTSW 7 82606479 splice site probably benign
R4618:Adamtsl3 UTSW 7 82606520 missense probably benign 0.41
R4842:Adamtsl3 UTSW 7 82528861 missense probably damaging 1.00
R4887:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4888:Adamtsl3 UTSW 7 82574614 missense possibly damaging 0.87
R4925:Adamtsl3 UTSW 7 82602299 critical splice donor site probably null
R4960:Adamtsl3 UTSW 7 82566977 missense probably damaging 0.99
R5026:Adamtsl3 UTSW 7 82576054 missense probably benign 0.07
R5152:Adamtsl3 UTSW 7 82574544 missense probably benign 0.11
R5198:Adamtsl3 UTSW 7 82611798 missense possibly damaging 0.63
R5244:Adamtsl3 UTSW 7 82598069 missense probably benign 0.02
R5281:Adamtsl3 UTSW 7 82528934 missense probably damaging 1.00
R5323:Adamtsl3 UTSW 7 82557061 missense probably damaging 1.00
R5523:Adamtsl3 UTSW 7 82574442 missense possibly damaging 0.86
R5602:Adamtsl3 UTSW 7 82557239 missense possibly damaging 0.89
R5638:Adamtsl3 UTSW 7 82611750 missense probably damaging 0.99
R5682:Adamtsl3 UTSW 7 82606550 missense probably damaging 0.99
R5782:Adamtsl3 UTSW 7 82540286 intron probably null
R5946:Adamtsl3 UTSW 7 82576057 missense probably damaging 0.98
R6091:Adamtsl3 UTSW 7 82465621 missense probably damaging 1.00
R6258:Adamtsl3 UTSW 7 82528983 critical splice donor site probably null
R6500:Adamtsl3 UTSW 7 82578610 missense probably benign 0.00
R6765:Adamtsl3 UTSW 7 82567024 missense possibly damaging 0.60
R6785:Adamtsl3 UTSW 7 82522004 missense probably damaging 0.99
R6982:Adamtsl3 UTSW 7 82515063 missense probably damaging 1.00
R7109:Adamtsl3 UTSW 7 82611861 missense
R7341:Adamtsl3 UTSW 7 82556874 missense probably damaging 1.00
R7402:Adamtsl3 UTSW 7 82578617 missense probably damaging 0.96
R7506:Adamtsl3 UTSW 7 82514978 missense probably damaging 1.00
R7549:Adamtsl3 UTSW 7 82573909 missense probably damaging 1.00
R7575:Adamtsl3 UTSW 7 82574548 missense possibly damaging 0.85
R7592:Adamtsl3 UTSW 7 82337251 missense probably benign 0.00
R7654:Adamtsl3 UTSW 7 82574494 missense probably benign
R7784:Adamtsl3 UTSW 7 82573989 missense probably damaging 1.00
R7858:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
R7941:Adamtsl3 UTSW 7 82450163 missense probably damaging 1.00
RF005:Adamtsl3 UTSW 7 82612395 missense
X0003:Adamtsl3 UTSW 7 82611759 nonsense probably null
X0063:Adamtsl3 UTSW 7 82574157 missense probably benign 0.25
Z1088:Adamtsl3 UTSW 7 82499714 missense probably damaging 1.00
Z1088:Adamtsl3 UTSW 7 82540325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGCAGAGCTATGATCCACT -3'
(R):5'- CCCCTTTAGAGTATTTATTGGCCA -3'

Sequencing Primer
(F):5'- AGAGCTATGATCCACTTCTTCTAAC -3'
(R):5'- TTCAGGCAGTTTTGTCCC -3'
Posted On2019-11-12