Incidental Mutation 'R7735:Kbtbd3'
ID596198
Institutional Source Beutler Lab
Gene Symbol Kbtbd3
Ensembl Gene ENSMUSG00000025893
Gene Namekelch repeat and BTB (POZ) domain containing 3
SynonymsBklhd3, 2200003A07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R7735 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location4309833-4331732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4330846 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 407 (K407E)
Ref Sequence ENSEMBL: ENSMUSP00000050183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049648] [ENSMUST00000212221]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049648
AA Change: K407E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050183
Gene: ENSMUSG00000025893
AA Change: K407E

DomainStartEndE-ValueType
BTB 48 145 1.83e-23 SMART
BACK 150 252 1.19e-26 SMART
Blast:Kelch 292 338 7e-15 BLAST
Kelch 339 399 2.56e0 SMART
Kelch 400 450 8.67e-4 SMART
Kelch 548 597 3.3e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000212221
AA Change: K407E

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,783,780 T617A probably benign Het
Agl A T 3: 116,785,146 I446N probably benign Het
Aox1 C T 1: 58,068,292 P575L probably benign Het
Ap2m1 A T 16: 20,539,519 I96F probably benign Het
Arhgap15 A G 2: 44,116,630 D253G probably damaging Het
Arsa A T 15: 89,474,949 C171* probably null Het
Arsb G T 13: 93,771,983 R69L probably benign Het
Canx G T 11: 50,301,039 D348E probably damaging Het
Cebpz C T 17: 78,925,913 probably null Het
Ces2h A T 8: 105,014,495 I40L probably benign Het
Csmd2 T C 4: 128,456,930 probably null Het
Cxadr T A 16: 78,329,061 N106K possibly damaging Het
Ddo T C 10: 40,631,774 C56R probably benign Het
Dnah6 C T 6: 73,069,429 G3192D probably damaging Het
Efcab3 T A 11: 105,071,639 V49E probably benign Het
Epha10 T C 4: 124,913,679 Y578H Het
Fbxw16 T C 9: 109,441,067 D202G probably damaging Het
Gm4788 A G 1: 139,732,301 probably null Het
Gzf1 T C 2: 148,688,163 V538A possibly damaging Het
Igha T A 12: 113,256,399 probably benign Het
Iqce G T 5: 140,678,084 Q457K probably benign Het
Lipt1 A G 1: 37,875,622 E253G probably damaging Het
Mrnip G A 11: 50,196,973 W107* probably null Het
Mroh4 T C 15: 74,625,508 T224A probably damaging Het
Ncoa2 A T 1: 13,148,437 S1389R probably benign Het
Npffr2 A G 5: 89,583,314 I368V probably benign Het
Nrd1 C T 4: 109,037,985 L469F probably damaging Het
Nup210l A T 3: 90,185,576 Q1279L probably damaging Het
Olfr1297 T A 2: 111,621,474 N200I probably damaging Het
Olfr862 A G 9: 19,884,114 Y64H probably damaging Het
Pcdha4 T G 18: 36,952,908 I48S probably damaging Het
Pip5kl1 A G 2: 32,579,089 Y211C possibly damaging Het
Ppil2 G T 16: 17,100,260 S97R probably benign Het
Prrt4 A T 6: 29,170,036 S806T possibly damaging Het
Ptpn20 T A 14: 33,630,945 Y214N probably damaging Het
Ptprt A T 2: 161,575,741 N938K probably damaging Het
Scn2a G T 2: 65,763,669 V1621L probably benign Het
Senp3 A G 11: 69,678,261 I358T probably damaging Het
Sf3b1 A T 1: 55,003,349 S461T probably benign Het
Slc22a2 C T 17: 12,610,030 T341I probably damaging Het
Slc38a7 A T 8: 95,841,667 D363E probably benign Het
Slc6a5 T C 7: 49,948,342 probably null Het
Smo T A 6: 29,759,852 V650E probably damaging Het
Spata17 G A 1: 187,140,380 T31I unknown Het
Sstr2 T A 11: 113,624,597 I114N possibly damaging Het
Styxl1 T C 5: 135,759,169 Y146C probably damaging Het
Synpo2l T C 14: 20,661,175 Q688R possibly damaging Het
Tmem245 C T 4: 56,925,155 R322H probably benign Het
Tnxb A G 17: 34,671,424 E247G unknown Het
Ttn A T 2: 76,888,072 I7255N unknown Het
Unc13b C T 4: 43,165,791 R204C probably damaging Het
Utrn A G 10: 12,744,043 probably null Het
Vps53 A T 11: 76,047,136 F753I probably damaging Het
Zdbf2 A G 1: 63,304,105 T548A possibly damaging Het
Zfp747 G A 7: 127,374,500 T166M probably damaging Het
Other mutations in Kbtbd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Kbtbd3 APN 9 4330169 missense probably benign
IGL00674:Kbtbd3 APN 9 4329949 missense probably benign 0.05
IGL00848:Kbtbd3 APN 9 4331184 missense probably damaging 1.00
IGL01949:Kbtbd3 APN 9 4331066 missense possibly damaging 0.95
IGL02619:Kbtbd3 APN 9 4331252 missense probably damaging 1.00
IGL02830:Kbtbd3 APN 9 4330096 missense possibly damaging 0.95
IGL02894:Kbtbd3 APN 9 4331444 missense probably benign 0.05
R0239:Kbtbd3 UTSW 9 4330144 missense possibly damaging 0.62
R0239:Kbtbd3 UTSW 9 4330144 missense possibly damaging 0.62
R0348:Kbtbd3 UTSW 9 4330519 missense possibly damaging 0.94
R0372:Kbtbd3 UTSW 9 4316950 missense possibly damaging 0.75
R0380:Kbtbd3 UTSW 9 4330545 nonsense probably null
R0644:Kbtbd3 UTSW 9 4329868 missense probably damaging 1.00
R1496:Kbtbd3 UTSW 9 4330276 missense probably benign
R1651:Kbtbd3 UTSW 9 4330589 missense possibly damaging 0.62
R1707:Kbtbd3 UTSW 9 4316985 missense probably benign 0.01
R1998:Kbtbd3 UTSW 9 4330760 missense probably benign 0.01
R2012:Kbtbd3 UTSW 9 4330919 missense probably benign
R2027:Kbtbd3 UTSW 9 4317075 splice site probably benign
R3717:Kbtbd3 UTSW 9 4330598 missense probably benign
R4463:Kbtbd3 UTSW 9 4331257 missense probably damaging 0.99
R4482:Kbtbd3 UTSW 9 4331051 missense probably damaging 1.00
R4795:Kbtbd3 UTSW 9 4331073 nonsense probably null
R5195:Kbtbd3 UTSW 9 4316905 missense possibly damaging 0.74
R5645:Kbtbd3 UTSW 9 4331426 missense possibly damaging 0.92
R5753:Kbtbd3 UTSW 9 4331404 missense possibly damaging 0.74
R5898:Kbtbd3 UTSW 9 4330476 missense probably damaging 0.97
R6463:Kbtbd3 UTSW 9 4316921 missense probably benign
R6681:Kbtbd3 UTSW 9 4330687 missense probably benign 0.00
R7284:Kbtbd3 UTSW 9 4330690 nonsense probably null
R7390:Kbtbd3 UTSW 9 4330424 missense probably benign 0.27
R7793:Kbtbd3 UTSW 9 4331221 missense probably damaging 1.00
R8005:Kbtbd3 UTSW 9 4330655 missense probably damaging 1.00
R8050:Kbtbd3 UTSW 9 4330408 missense probably benign 0.43
X0024:Kbtbd3 UTSW 9 4331437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAGGATCTAGTCTGTCTAGC -3'
(R):5'- CGGCAATCTCTACCTCAGATC -3'

Sequencing Primer
(F):5'- CCAGGATCTAGTCTGTCTAGCTATGG -3'
(R):5'- CCAAGGACATAAATGATATTCTGGC -3'
Posted On2019-11-26