Incidental Mutation 'R7735:Ces2h'
ID596197
Institutional Source Beutler Lab
Gene Symbol Ces2h
Ensembl Gene ENSMUSG00000091813
Gene Namecarboxylesterase 2H
SynonymsGm5744
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7735 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location105000853-105021178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105014495 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 40 (I40L)
Ref Sequence ENSEMBL: ENSMUSP00000126773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172032]
Predicted Effect probably benign
Transcript: ENSMUST00000172032
AA Change: I40L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000126773
Gene: ENSMUSG00000091813
AA Change: I40L

DomainStartEndE-ValueType
Pfam:COesterase 9 537 2.5e-167 PFAM
Pfam:Abhydrolase_3 142 275 4.1e-11 PFAM
Pfam:Peptidase_S9 161 326 3.3e-8 PFAM
coiled coil region 538 558 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. The protein encoded by this gene is the major intestinal enzyme and functions in intestine drug clearance. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,783,780 T617A probably benign Het
Agl A T 3: 116,785,146 I446N probably benign Het
Aox1 C T 1: 58,068,292 P575L probably benign Het
Ap2m1 A T 16: 20,539,519 I96F probably benign Het
Arhgap15 A G 2: 44,116,630 D253G probably damaging Het
Arsa A T 15: 89,474,949 C171* probably null Het
Arsb G T 13: 93,771,983 R69L probably benign Het
Canx G T 11: 50,301,039 D348E probably damaging Het
Cebpz C T 17: 78,925,913 probably null Het
Csmd2 T C 4: 128,456,930 probably null Het
Cxadr T A 16: 78,329,061 N106K possibly damaging Het
Ddo T C 10: 40,631,774 C56R probably benign Het
Dnah6 C T 6: 73,069,429 G3192D probably damaging Het
Efcab3 T A 11: 105,071,639 V49E probably benign Het
Epha10 T C 4: 124,913,679 Y578H Het
Fbxw16 T C 9: 109,441,067 D202G probably damaging Het
Gm4788 A G 1: 139,732,301 probably null Het
Gzf1 T C 2: 148,688,163 V538A possibly damaging Het
Igha T A 12: 113,256,399 probably benign Het
Iqce G T 5: 140,678,084 Q457K probably benign Het
Kbtbd3 A G 9: 4,330,846 K407E possibly damaging Het
Lipt1 A G 1: 37,875,622 E253G probably damaging Het
Mrnip G A 11: 50,196,973 W107* probably null Het
Mroh4 T C 15: 74,625,508 T224A probably damaging Het
Ncoa2 A T 1: 13,148,437 S1389R probably benign Het
Npffr2 A G 5: 89,583,314 I368V probably benign Het
Nrd1 C T 4: 109,037,985 L469F probably damaging Het
Nup210l A T 3: 90,185,576 Q1279L probably damaging Het
Olfr1297 T A 2: 111,621,474 N200I probably damaging Het
Olfr862 A G 9: 19,884,114 Y64H probably damaging Het
Pcdha4 T G 18: 36,952,908 I48S probably damaging Het
Pip5kl1 A G 2: 32,579,089 Y211C possibly damaging Het
Ppil2 G T 16: 17,100,260 S97R probably benign Het
Prrt4 A T 6: 29,170,036 S806T possibly damaging Het
Ptpn20 T A 14: 33,630,945 Y214N probably damaging Het
Ptprt A T 2: 161,575,741 N938K probably damaging Het
Scn2a G T 2: 65,763,669 V1621L probably benign Het
Senp3 A G 11: 69,678,261 I358T probably damaging Het
Sf3b1 A T 1: 55,003,349 S461T probably benign Het
Slc22a2 C T 17: 12,610,030 T341I probably damaging Het
Slc38a7 A T 8: 95,841,667 D363E probably benign Het
Slc6a5 T C 7: 49,948,342 probably null Het
Smo T A 6: 29,759,852 V650E probably damaging Het
Spata17 G A 1: 187,140,380 T31I unknown Het
Sstr2 T A 11: 113,624,597 I114N possibly damaging Het
Styxl1 T C 5: 135,759,169 Y146C probably damaging Het
Synpo2l T C 14: 20,661,175 Q688R possibly damaging Het
Tmem245 C T 4: 56,925,155 R322H probably benign Het
Tnxb A G 17: 34,671,424 E247G unknown Het
Ttn A T 2: 76,888,072 I7255N unknown Het
Unc13b C T 4: 43,165,791 R204C probably damaging Het
Utrn A G 10: 12,744,043 probably null Het
Vps53 A T 11: 76,047,136 F753I probably damaging Het
Zdbf2 A G 1: 63,304,105 T548A possibly damaging Het
Zfp747 G A 7: 127,374,500 T166M probably damaging Het
Other mutations in Ces2h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Ces2h APN 8 105014484 missense probably benign 0.01
IGL02268:Ces2h APN 8 105019940 missense probably benign 0.00
IGL03133:Ces2h APN 8 105016779 missense probably damaging 1.00
R0138:Ces2h UTSW 8 105018061 missense probably benign 0.01
R0294:Ces2h UTSW 8 105016604 missense probably benign 0.01
R0482:Ces2h UTSW 8 105020271 missense possibly damaging 0.48
R0899:Ces2h UTSW 8 105014550 missense probably damaging 1.00
R1232:Ces2h UTSW 8 105014655 missense probably benign 0.38
R1535:Ces2h UTSW 8 105014486 missense probably benign 0.06
R1738:Ces2h UTSW 8 105019065 critical splice donor site probably null
R1748:Ces2h UTSW 8 105017841 missense probably benign 0.00
R1759:Ces2h UTSW 8 105016611 missense probably damaging 1.00
R1778:Ces2h UTSW 8 105014607 missense possibly damaging 0.93
R1833:Ces2h UTSW 8 105020373 missense possibly damaging 0.93
R1999:Ces2h UTSW 8 105020345 missense probably benign 0.03
R2018:Ces2h UTSW 8 105018398 missense probably damaging 1.00
R2076:Ces2h UTSW 8 105019028 missense probably benign
R2261:Ces2h UTSW 8 105016559 missense probably damaging 0.99
R2262:Ces2h UTSW 8 105016559 missense probably damaging 0.99
R2356:Ces2h UTSW 8 105015938 missense probably damaging 0.98
R4453:Ces2h UTSW 8 105014656 critical splice donor site probably null
R4656:Ces2h UTSW 8 105014639 missense possibly damaging 0.80
R4732:Ces2h UTSW 8 105014604 missense probably damaging 0.97
R4733:Ces2h UTSW 8 105014604 missense probably damaging 0.97
R5219:Ces2h UTSW 8 105016646 missense probably damaging 1.00
R5400:Ces2h UTSW 8 105018425 missense probably benign 0.01
R5696:Ces2h UTSW 8 105018979 missense possibly damaging 0.69
R5894:Ces2h UTSW 8 105019026 missense probably benign 0.14
R6688:Ces2h UTSW 8 105017840 missense probably benign
R6711:Ces2h UTSW 8 105018083 missense probably benign 0.22
R6868:Ces2h UTSW 8 105018423 missense probably benign 0.02
R7233:Ces2h UTSW 8 105017456 missense probably damaging 0.99
R7516:Ces2h UTSW 8 105016826 missense probably damaging 1.00
R7710:Ces2h UTSW 8 105000865 nonsense probably null
R7803:Ces2h UTSW 8 105018400 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTGAGACCCCTGTAACAG -3'
(R):5'- GCTTGAGATGAGGAGCCATG -3'

Sequencing Primer
(F):5'- CCCCTGTAACAGATAATAAGTGTGTG -3'
(R):5'- ATGGAAGTCCGGCCCAGAATTC -3'
Posted On2019-11-26