Incidental Mutation 'R7743:Tead3'
ID596707
Institutional Source Beutler Lab
Gene Symbol Tead3
Ensembl Gene ENSMUSG00000002249
Gene NameTEA domain family member 3
SynonymsDTEF-1, TEF-5, Tcf13r2, ETFR-1, TEAD-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7743 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location28331671-28350805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28332827 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 431 (T431S)
Ref Sequence ENSEMBL: ENSMUSP00000110447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042334] [ENSMUST00000114799] [ENSMUST00000129935] [ENSMUST00000154873] [ENSMUST00000156862] [ENSMUST00000219703]
Predicted Effect probably benign
Transcript: ENSMUST00000042334
SMART Domains Protein: ENSMUSP00000048469
Gene: ENSMUSG00000037805

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 12 213 3.5e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114799
AA Change: T431S

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000110447
Gene: ENSMUSG00000002249
AA Change: T431S

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
TEA 52 123 9.04e-52 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 227 244 N/A INTRINSIC
PDB:3KYS|C 248 465 1e-120 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000129935
SMART Domains Protein: ENSMUSP00000114141
Gene: ENSMUSG00000037805

DomainStartEndE-ValueType
Pfam:Ribosomal_L1 3 57 1.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154873
AA Change: T340S

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118582
Gene: ENSMUSG00000002249
AA Change: T340S

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156862
AA Change: T340S

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000115443
Gene: ENSMUSG00000002249
AA Change: T340S

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219703
AA Change: T405S

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is predominantly expressed in the placenta and thought to play a role in placental gene regulation and development. Alternative splicing, and alternate use of an upstream AUG translation initiation codon, and an in-frame downstream non-AUG (AUA) codon, results in 2 isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,755 E1235G probably damaging Het
Adam6a A G 12: 113,544,532 D175G probably benign Het
Adgrf4 A T 17: 42,672,562 C76* probably null Het
Agbl3 C T 6: 34,846,830 T815I probably damaging Het
Ahnak2 A G 12: 112,784,763 V488A not run Het
Akip1 T A 7: 109,711,828 S192T probably benign Het
Apc2 G A 10: 80,304,915 M201I probably damaging Het
Arel1 G T 12: 84,940,269 N124K probably damaging Het
Atp10a A T 7: 58,803,709 H845L probably damaging Het
Atp2a2 A G 5: 122,461,571 Y586H probably benign Het
BC051019 A G 7: 109,716,059 Y330H probably damaging Het
Btbd11 A T 10: 85,624,949 I569F possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Chek2 T G 5: 110,840,050 probably null Het
Cldn14 A G 16: 93,919,727 L77S probably damaging Het
Cox15 T C 19: 43,739,941 K298E possibly damaging Het
Cpt1b G T 15: 89,421,404 D369E probably benign Het
Cpxm1 T C 2: 130,393,422 N550S probably benign Het
Csdc2 A G 15: 81,949,198 E132G possibly damaging Het
Cyb5d2 A T 11: 72,778,876 C219S probably damaging Het
Erbb4 T C 1: 68,328,119 T480A probably benign Het
Fndc1 G A 17: 7,765,137 T1319I unknown Het
Gm5773 T G 3: 93,773,258 V79G probably damaging Het
Itgb2l T C 16: 96,437,408 T64A probably damaging Het
Kifc5b T C 17: 26,924,202 V316A probably damaging Het
Ktn1 A G 14: 47,670,293 D279G probably damaging Het
Lonrf1 T C 8: 36,249,052 E143G possibly damaging Het
Mroh9 C T 1: 163,024,553 E856K probably benign Het
Muc16 T C 9: 18,657,477 T1249A unknown Het
Myh6 G A 14: 54,957,150 R721W probably damaging Het
Myo6 A T 9: 80,276,329 I669F unknown Het
N4bp2 A G 5: 65,808,459 T1284A probably damaging Het
Npr3 A G 15: 11,905,638 M1T probably null Het
Obscn C T 11: 59,099,777 V1657M probably damaging Het
Olfr243 A G 7: 103,717,353 E253G possibly damaging Het
Olfr551 A T 7: 102,588,431 F104Y probably benign Het
Olfr908 A G 9: 38,516,328 T99A possibly damaging Het
Otud6b C A 4: 14,818,389 A171S possibly damaging Het
Pdcd2l A C 7: 34,192,831 D204E probably benign Het
Pdia2 T C 17: 26,198,868 S56G probably benign Het
Plcxd1 G A 5: 110,102,503 E237K possibly damaging Het
Plekha5 A T 6: 140,555,986 R633S probably damaging Het
Pnpla6 T C 8: 3,536,594 F937L possibly damaging Het
Pth2 A T 7: 45,181,309 M6L probably benign Het
Ptprd T A 4: 76,086,089 K143I probably damaging Het
Rhbdf2 T C 11: 116,601,601 D487G probably benign Het
Rhbdf2 A T 11: 116,603,949 D300E probably benign Het
Rock2 G A 12: 16,976,047 V1265I probably damaging Het
Rsf1 CGGC CGGCGGCGGAGGC 7: 97,579,932 probably benign Het
Rtn4 T A 11: 29,733,790 Y1027* probably null Het
Rxfp3 A G 15: 11,037,130 L52P probably damaging Het
Sel1l3 A G 5: 53,135,885 Y830H probably benign Het
Serpinb3d C T 1: 107,079,358 V207I probably damaging Het
Sipa1l2 T C 8: 125,464,233 E1006G probably damaging Het
Slc22a19 C T 19: 7,683,836 M324I possibly damaging Het
Slc37a1 T A 17: 31,316,185 F106I probably damaging Het
Snx14 A T 9: 88,398,349 S518T probably benign Het
Sp2 T C 11: 96,961,109 T330A probably damaging Het
Spata13 A T 14: 60,756,249 H1050L probably damaging Het
Sptssa A C 12: 54,656,416 V23G possibly damaging Het
Syt3 A T 7: 44,392,667 I317F probably damaging Het
Tiam2 G A 17: 3,518,156 E1526K possibly damaging Het
Tnni3 G A 7: 4,521,892 P12L probably benign Het
Topaz1 A G 9: 122,785,136 H1207R probably benign Het
Trdn G T 10: 33,257,062 E107* probably null Het
Trp63 A G 16: 25,882,625 N483S probably benign Het
Trpm4 A G 7: 45,308,338 S1009P probably benign Het
Trpm6 T C 19: 18,827,408 V908A probably benign Het
Tsen34 A T 7: 3,694,602 M25L possibly damaging Het
Ttn T C 2: 76,951,483 E1073G unknown Het
Uaca A T 9: 60,876,395 I1380F probably damaging Het
Ubr3 A G 2: 69,944,449 T539A probably benign Het
Ugt1a5 T A 1: 88,166,395 M115K probably benign Het
Unc45b A T 11: 82,922,900 I378F probably damaging Het
Unk G A 11: 116,049,436 R205Q possibly damaging Het
Ush2a T A 1: 188,810,179 L3314Q probably benign Het
Vezt A G 10: 93,980,424 L475P probably damaging Het
Vmn2r115 C T 17: 23,345,798 Q220* probably null Het
Yap1 T C 9: 7,962,378 Q223R probably benign Het
Zdhhc7 G A 8: 120,086,728 T114M possibly damaging Het
Zwilch A C 9: 64,152,935 C374G probably damaging Het
Other mutations in Tead3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Tead3 APN 17 28332806 missense possibly damaging 0.91
IGL01752:Tead3 APN 17 28333594 missense probably damaging 1.00
IGL01760:Tead3 APN 17 28333081 missense probably benign 0.07
IGL02868:Tead3 APN 17 28333095 nonsense probably null
IGL02932:Tead3 APN 17 28341351 missense probably damaging 1.00
R0015:Tead3 UTSW 17 28341351 missense probably damaging 1.00
R0376:Tead3 UTSW 17 28341365 missense probably damaging 0.98
R0383:Tead3 UTSW 17 28334698 splice site probably null
R1203:Tead3 UTSW 17 28341562 missense probably benign 0.06
R1699:Tead3 UTSW 17 28334724 missense possibly damaging 0.52
R2037:Tead3 UTSW 17 28336570 missense probably damaging 0.98
R2148:Tead3 UTSW 17 28333664 missense probably damaging 1.00
R4871:Tead3 UTSW 17 28333615 missense probably damaging 1.00
R4871:Tead3 UTSW 17 28334988 missense probably benign 0.42
R5070:Tead3 UTSW 17 28341477 missense probably benign 0.06
R5557:Tead3 UTSW 17 28336270 intron probably benign
R5891:Tead3 UTSW 17 28341365 missense probably damaging 0.98
R5991:Tead3 UTSW 17 28334378 splice site probably null
R6335:Tead3 UTSW 17 28333325 missense probably damaging 1.00
R6999:Tead3 UTSW 17 28341532 missense probably benign 0.00
R7165:Tead3 UTSW 17 28333254 missense probably benign 0.00
R7718:Tead3 UTSW 17 28333517 missense probably damaging 1.00
R8025:Tead3 UTSW 17 28335035 missense probably benign 0.23
R8034:Tead3 UTSW 17 28333229 missense probably damaging 1.00
X0066:Tead3 UTSW 17 28341427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCAGTAAAGCGCAGAAC -3'
(R):5'- CTGCCCGAGAAGTACATGATG -3'

Sequencing Primer
(F):5'- TGGGTCCCAGCCTGAAAC -3'
(R):5'- TGAACAGTGTGCTGGAGAACTTC -3'
Posted On2019-11-26