Incidental Mutation 'R7743:Ubr3'
ID596636
Institutional Source Beutler Lab
Gene Symbol Ubr3
Ensembl Gene ENSMUSG00000044308
Gene Nameubiquitin protein ligase E3 component n-recognin 3
SynonymsZfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7743 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location69897246-70024013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69944449 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 539 (T539A)
Ref Sequence ENSEMBL: ENSMUSP00000060159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]
Predicted Effect probably benign
Transcript: ENSMUST00000055758
AA Change: T539A

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: T539A

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 118 188 1.6e-19 PFAM
low complexity region 339 354 N/A INTRINSIC
low complexity region 570 580 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1082 1101 N/A INTRINSIC
coiled coil region 1167 1199 N/A INTRINSIC
Blast:RING 1289 1363 8e-39 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112251
AA Change: T538A

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: T538A

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 119 187 1.7e-21 PFAM
low complexity region 338 353 N/A INTRINSIC
low complexity region 569 579 N/A INTRINSIC
low complexity region 1015 1026 N/A INTRINSIC
low complexity region 1081 1100 N/A INTRINSIC
coiled coil region 1166 1198 N/A INTRINSIC
Blast:RING 1288 1362 8e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 97% (77/79)
MGI Phenotype PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,755 E1235G probably damaging Het
Adam6a A G 12: 113,544,532 D175G probably benign Het
Adgrf4 A T 17: 42,672,562 C76* probably null Het
Agbl3 C T 6: 34,846,830 T815I probably damaging Het
Ahnak2 A G 12: 112,784,763 V488A not run Het
Akip1 T A 7: 109,711,828 S192T probably benign Het
Apc2 G A 10: 80,304,915 M201I probably damaging Het
Arel1 G T 12: 84,940,269 N124K probably damaging Het
Atp10a A T 7: 58,803,709 H845L probably damaging Het
Atp2a2 A G 5: 122,461,571 Y586H probably benign Het
BC051019 A G 7: 109,716,059 Y330H probably damaging Het
Btbd11 A T 10: 85,624,949 I569F possibly damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Chek2 T G 5: 110,840,050 probably null Het
Cldn14 A G 16: 93,919,727 L77S probably damaging Het
Cox15 T C 19: 43,739,941 K298E possibly damaging Het
Cpt1b G T 15: 89,421,404 D369E probably benign Het
Cpxm1 T C 2: 130,393,422 N550S probably benign Het
Csdc2 A G 15: 81,949,198 E132G possibly damaging Het
Cyb5d2 A T 11: 72,778,876 C219S probably damaging Het
Erbb4 T C 1: 68,328,119 T480A probably benign Het
Fndc1 G A 17: 7,765,137 T1319I unknown Het
Gm5773 T G 3: 93,773,258 V79G probably damaging Het
Hsf2 G A 10: 57,511,335 probably null Het
Itgb2l T C 16: 96,437,408 T64A probably damaging Het
Kifc5b T C 17: 26,924,202 V316A probably damaging Het
Ktn1 A G 14: 47,670,293 D279G probably damaging Het
Lonrf1 T C 8: 36,249,052 E143G possibly damaging Het
Mroh9 C T 1: 163,024,553 E856K probably benign Het
Muc16 T C 9: 18,657,477 T1249A unknown Het
Myh6 G A 14: 54,957,150 R721W probably damaging Het
Myo6 A T 9: 80,276,329 I669F unknown Het
N4bp2 A G 5: 65,808,459 T1284A probably damaging Het
Npr3 A G 15: 11,905,638 M1T probably null Het
Obscn C T 11: 59,099,777 V1657M probably damaging Het
Olfr243 A G 7: 103,717,353 E253G possibly damaging Het
Olfr551 A T 7: 102,588,431 F104Y probably benign Het
Olfr908 A G 9: 38,516,328 T99A possibly damaging Het
Otud6b C A 4: 14,818,389 A171S possibly damaging Het
Pdcd2l A C 7: 34,192,831 D204E probably benign Het
Pdia2 T C 17: 26,198,868 S56G probably benign Het
Plcxd1 G A 5: 110,102,503 E237K possibly damaging Het
Plekha5 A T 6: 140,555,986 R633S probably damaging Het
Pnpla6 T C 8: 3,536,594 F937L possibly damaging Het
Pth2 A T 7: 45,181,309 M6L probably benign Het
Ptprd T A 4: 76,086,089 K143I probably damaging Het
Rhbdf2 T C 11: 116,601,601 D487G probably benign Het
Rhbdf2 A T 11: 116,603,949 D300E probably benign Het
Rock2 G A 12: 16,976,047 V1265I probably damaging Het
Rsf1 CGGC CGGCGGCGGAGGC 7: 97,579,932 probably benign Het
Rtn4 T A 11: 29,733,790 Y1027* probably null Het
Rxfp3 A G 15: 11,037,130 L52P probably damaging Het
Sel1l3 A G 5: 53,135,885 Y830H probably benign Het
Serpinb3d C T 1: 107,079,358 V207I probably damaging Het
Sipa1l2 T C 8: 125,464,233 E1006G probably damaging Het
Slc22a19 C T 19: 7,683,836 M324I possibly damaging Het
Slc37a1 T A 17: 31,316,185 F106I probably damaging Het
Snx14 A T 9: 88,398,349 S518T probably benign Het
Sp2 T C 11: 96,961,109 T330A probably damaging Het
Spata13 A T 14: 60,756,249 H1050L probably damaging Het
Sptssa A C 12: 54,656,416 V23G possibly damaging Het
Syt3 A T 7: 44,392,667 I317F probably damaging Het
Tars A C 15: 11,399,372 probably null Het
Tead3 T A 17: 28,332,827 T431S probably benign Het
Tiam2 G A 17: 3,518,156 E1526K possibly damaging Het
Tnni3 G A 7: 4,521,892 P12L probably benign Het
Topaz1 A G 9: 122,785,136 H1207R probably benign Het
Trdn G T 10: 33,257,062 E107* probably null Het
Trp63 A G 16: 25,882,625 N483S probably benign Het
Trpm4 A G 7: 45,308,338 S1009P probably benign Het
Trpm6 T C 19: 18,827,408 V908A probably benign Het
Tsen34 A T 7: 3,694,602 M25L possibly damaging Het
Ttn T C 2: 76,951,483 E1073G unknown Het
Uaca A T 9: 60,876,395 I1380F probably damaging Het
Ugt1a5 T A 1: 88,166,395 M115K probably benign Het
Unc45b A T 11: 82,922,900 I378F probably damaging Het
Unk G A 11: 116,049,436 R205Q possibly damaging Het
Ush2a T A 1: 188,810,179 L3314Q probably benign Het
Vezt A G 10: 93,980,424 L475P probably damaging Het
Vmn2r115 C T 17: 23,345,798 Q220* probably null Het
Yap1 T C 9: 7,962,378 Q223R probably benign Het
Zdhhc7 G A 8: 120,086,728 T114M possibly damaging Het
Zwilch A C 9: 64,152,935 C374G probably damaging Het
Other mutations in Ubr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ubr3 APN 2 69988810 missense probably benign 0.40
IGL00985:Ubr3 APN 2 70003431 missense probably damaging 1.00
IGL01061:Ubr3 APN 2 69983225 missense probably benign 0.05
IGL01325:Ubr3 APN 2 69917097 missense possibly damaging 0.71
IGL01398:Ubr3 APN 2 69959653 missense probably damaging 1.00
IGL01484:Ubr3 APN 2 70021544 nonsense probably null
IGL01599:Ubr3 APN 2 69938178 missense probably damaging 1.00
IGL01616:Ubr3 APN 2 70020484 missense probably benign 0.14
IGL01634:Ubr3 APN 2 69973572 missense probably benign
IGL01684:Ubr3 APN 2 70016158 nonsense probably null
IGL01810:Ubr3 APN 2 70003465 splice site probably null
IGL01813:Ubr3 APN 2 69951570 missense probably benign 0.34
IGL01994:Ubr3 APN 2 70021176 missense probably damaging 1.00
IGL02188:Ubr3 APN 2 69959611 nonsense probably null
IGL02318:Ubr3 APN 2 69979397 missense probably damaging 1.00
IGL02379:Ubr3 APN 2 69948488 missense possibly damaging 0.91
IGL02635:Ubr3 APN 2 70020483 missense probably damaging 0.96
IGL02858:Ubr3 APN 2 69952859 missense probably damaging 1.00
IGL03140:Ubr3 APN 2 69970189 missense probably damaging 1.00
IGL03343:Ubr3 APN 2 69973146 splice site probably benign
Hyrax UTSW 2 69952868 missense probably benign 0.32
manatee UTSW 2 69979386 nonsense probably null
sea_cow UTSW 2 69959669 splice site probably null
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0122:Ubr3 UTSW 2 69979412 missense probably damaging 1.00
R0243:Ubr3 UTSW 2 69951405 missense probably damaging 1.00
R0710:Ubr3 UTSW 2 69952837 missense probably damaging 1.00
R0787:Ubr3 UTSW 2 69951421 splice site probably benign
R1137:Ubr3 UTSW 2 69938315 splice site probably benign
R1191:Ubr3 UTSW 2 70021181 nonsense probably null
R1416:Ubr3 UTSW 2 69945071 missense probably damaging 1.00
R1623:Ubr3 UTSW 2 69977723 nonsense probably null
R1735:Ubr3 UTSW 2 70009129 missense probably damaging 1.00
R1789:Ubr3 UTSW 2 70016367 missense possibly damaging 0.87
R1793:Ubr3 UTSW 2 70000551 splice site probably benign
R1932:Ubr3 UTSW 2 69953476 splice site probably null
R2042:Ubr3 UTSW 2 69977774 nonsense probably null
R2085:Ubr3 UTSW 2 69953764 missense probably damaging 1.00
R2090:Ubr3 UTSW 2 69936017 missense probably damaging 1.00
R2112:Ubr3 UTSW 2 69977792 missense possibly damaging 0.73
R2173:Ubr3 UTSW 2 69897399 missense probably benign
R2215:Ubr3 UTSW 2 69979317 critical splice acceptor site probably null
R2273:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2274:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2275:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2292:Ubr3 UTSW 2 69897260 unclassified probably benign
R2447:Ubr3 UTSW 2 70003380 missense probably damaging 1.00
R2504:Ubr3 UTSW 2 69938198 missense probably damaging 0.99
R2517:Ubr3 UTSW 2 69936018 missense probably damaging 1.00
R2901:Ubr3 UTSW 2 70016192 missense possibly damaging 0.89
R3109:Ubr3 UTSW 2 69988840 missense probably damaging 1.00
R3737:Ubr3 UTSW 2 69971234 critical splice donor site probably null
R3793:Ubr3 UTSW 2 69917181 missense possibly damaging 0.95
R3821:Ubr3 UTSW 2 69993813 critical splice donor site probably null
R3918:Ubr3 UTSW 2 70016130 critical splice acceptor site probably null
R4157:Ubr3 UTSW 2 69959669 splice site probably null
R4235:Ubr3 UTSW 2 70016385 nonsense probably null
R4276:Ubr3 UTSW 2 69938387 nonsense probably null
R4544:Ubr3 UTSW 2 69956093 missense probably benign 0.18
R4678:Ubr3 UTSW 2 69935919 missense probably damaging 1.00
R4707:Ubr3 UTSW 2 69938370 intron probably benign
R4785:Ubr3 UTSW 2 69959603 missense probably damaging 1.00
R4872:Ubr3 UTSW 2 69970183 missense probably damaging 1.00
R4887:Ubr3 UTSW 2 70013131 missense probably damaging 0.99
R4920:Ubr3 UTSW 2 69952868 missense probably benign 0.32
R4989:Ubr3 UTSW 2 70020446 splice site probably benign
R5104:Ubr3 UTSW 2 69938256 missense probably damaging 0.98
R5134:Ubr3 UTSW 2 70020446 splice site probably benign
R5137:Ubr3 UTSW 2 69973335 missense probably damaging 1.00
R5174:Ubr3 UTSW 2 70009162 missense probably damaging 1.00
R5195:Ubr3 UTSW 2 69956034 missense probably benign 0.00
R5437:Ubr3 UTSW 2 69944390 missense probably damaging 1.00
R5539:Ubr3 UTSW 2 70020533 missense probably damaging 1.00
R5781:Ubr3 UTSW 2 70016244 splice site probably null
R5809:Ubr3 UTSW 2 69965511 missense possibly damaging 0.90
R5913:Ubr3 UTSW 2 70021215 missense probably damaging 1.00
R5969:Ubr3 UTSW 2 69979386 nonsense probably null
R6136:Ubr3 UTSW 2 69993763 missense probably benign 0.26
R6140:Ubr3 UTSW 2 69973329 missense probably benign 0.09
R6185:Ubr3 UTSW 2 69938277 missense probably damaging 0.98
R6220:Ubr3 UTSW 2 70020475 missense probably damaging 1.00
R6258:Ubr3 UTSW 2 69982864 splice site probably null
R6319:Ubr3 UTSW 2 69973414 missense probably benign 0.00
R6322:Ubr3 UTSW 2 69956085 nonsense probably null
R6470:Ubr3 UTSW 2 69965460 missense probably benign 0.02
R6477:Ubr3 UTSW 2 69979429 nonsense probably null
R6702:Ubr3 UTSW 2 69956049 missense probably benign 0.23
R6709:Ubr3 UTSW 2 70013092 missense probably damaging 1.00
R6803:Ubr3 UTSW 2 69936024 critical splice donor site probably null
R6806:Ubr3 UTSW 2 69955964 splice site probably benign
R6834:Ubr3 UTSW 2 70000481 missense possibly damaging 0.63
R6841:Ubr3 UTSW 2 70020625 missense probably damaging 1.00
R6847:Ubr3 UTSW 2 69983128 missense probably damaging 1.00
R6889:Ubr3 UTSW 2 69944300 missense possibly damaging 0.70
R7065:Ubr3 UTSW 2 69953705 missense probably damaging 1.00
R7102:Ubr3 UTSW 2 69897822 missense probably damaging 1.00
R7156:Ubr3 UTSW 2 70021623 missense probably damaging 1.00
R7209:Ubr3 UTSW 2 70016134 missense probably benign 0.01
R7273:Ubr3 UTSW 2 69979333 missense probably damaging 0.97
R7314:Ubr3 UTSW 2 69991600 missense probably damaging 1.00
R7422:Ubr3 UTSW 2 69953542 critical splice donor site probably null
R7584:Ubr3 UTSW 2 69991503 missense probably damaging 1.00
R7588:Ubr3 UTSW 2 69971169 missense probably damaging 1.00
R7597:Ubr3 UTSW 2 69973468 missense possibly damaging 0.69
R7697:Ubr3 UTSW 2 69897686 missense probably damaging 1.00
R7737:Ubr3 UTSW 2 69991566 missense probably benign 0.07
R7946:Ubr3 UTSW 2 69951395 missense possibly damaging 0.95
R7991:Ubr3 UTSW 2 69952856 missense probably damaging 1.00
R8071:Ubr3 UTSW 2 69988876 missense probably damaging 0.99
R8136:Ubr3 UTSW 2 70021179 missense probably damaging 1.00
R8296:Ubr3 UTSW 2 69954362 missense probably null 1.00
R8313:Ubr3 UTSW 2 69945134 missense probably damaging 0.99
Z1088:Ubr3 UTSW 2 69922367 missense probably benign 0.00
Z1177:Ubr3 UTSW 2 69897461 missense probably benign 0.17
Z1177:Ubr3 UTSW 2 69897666 missense probably damaging 1.00
Z1177:Ubr3 UTSW 2 69973206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCCAAGTGTTTCTGATTCTAAG -3'
(R):5'- GCTAGCCCAAATTGTTACAAACAGG -3'

Sequencing Primer
(F):5'- CCAAGTGTTTCTGATTCTAAGATGTG -3'
(R):5'- TCCTTGCTATGTTGCTGTAAATAAC -3'
Posted On2019-11-26