Incidental Mutation 'R7791:Htr3a'
ID599883
Institutional Source Beutler Lab
Gene Symbol Htr3a
Ensembl Gene ENSMUSG00000032269
Gene Name5-hydroxytryptamine (serotonin) receptor 3A
Synonyms5-HT3 receptor
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7791 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location48899213-48911099 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48901575 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 188 (Q188L)
Ref Sequence ENSEMBL: ENSMUSP00000003826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003826] [ENSMUST00000217289]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003826
AA Change: Q188L

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003826
Gene: ENSMUSG00000032269
AA Change: Q188L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:Neur_chan_LBD 40 247 4.7e-57 PFAM
Pfam:Neur_chan_memb 254 480 1.8e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217289
AA Change: Q188L

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit A of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It appears that the heteromeric combination of A and B subunits is necessary to provide the full functional features of this receptor, since either subunit alone results in receptors with very low conductance and response amplitude. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display a decreased lifespan, cachexia, increased blood urea nitrogen, proteinuria, kidney inflammation, and a hyperdistended and neurogenic urinary bladder. Mice homozygous for a second null mutation display reduced chemical pain persistence responses but are otherwise healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik A T 13: 59,690,694 M108K probably benign Het
Adamts9 A T 6: 92,872,385 V1031D probably benign Het
Agap3 C T 5: 24,476,413 R122C probably damaging Het
Arhgap27 A G 11: 103,339,194 probably null Het
Atp1a2 T A 1: 172,276,215 I950F probably benign Het
Bahcc1 T G 11: 120,268,377 H143Q probably damaging Het
Bcl7b T A 5: 135,171,114 D40E probably damaging Het
C9 C T 15: 6,489,878 R399C possibly damaging Het
Capn13 T C 17: 73,382,888 I43V possibly damaging Het
Ctcf A G 8: 105,664,939 T289A possibly damaging Het
Cux2 T C 5: 121,867,099 N1008S probably benign Het
Dst T A 1: 34,154,592 M294K probably damaging Het
Eml4 G T 17: 83,473,706 D778Y probably benign Het
Exoc3l4 A C 12: 111,423,540 D183A probably damaging Het
Eya4 A T 10: 23,113,926 S511T probably damaging Het
Fbrsl1 T C 5: 110,448,019 H50R probably benign Het
Gemin5 G A 11: 58,124,993 P1396S probably benign Het
Gm13178 A G 4: 144,703,445 S325P probably damaging Het
Gnb4 A G 3: 32,590,043 F151L possibly damaging Het
Gnptab A G 10: 88,440,222 probably null Het
Gpbp1l1 T A 4: 116,574,420 W92R probably damaging Het
Gucy1b1 A T 3: 82,035,397 Y479* probably null Het
Ighv5-9-1 A G 12: 113,736,545 F18S probably damaging Het
Loxhd1 A G 18: 77,383,729 T1004A probably damaging Het
Mansc4 G A 6: 147,081,544 L132F unknown Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mtor G T 4: 148,462,940 R460L probably benign Het
Mtus1 A T 8: 41,083,380 F433Y possibly damaging Het
Myoc T C 1: 162,649,121 Y465H probably damaging Het
N4bp1 A G 8: 86,853,203 V657A probably damaging Het
Nectin1 T C 9: 43,792,039 I198T probably benign Het
Olfr239 T A 17: 33,199,352 C101* probably null Het
Olfr44 T C 9: 39,484,881 D124G probably damaging Het
Padi2 C T 4: 140,917,596 T47I probably benign Het
Pdia4 A T 6: 47,807,122 I116N probably damaging Het
Pkdrej T A 15: 85,815,931 I1935L possibly damaging Het
Pnpla7 C A 2: 25,052,066 A1173D probably damaging Het
Ralgapa1 A T 12: 55,741,519 L593Q probably damaging Het
Scn5a A G 9: 119,543,336 S231P possibly damaging Het
Slc13a2 A G 11: 78,422,064 probably null Het
Spdl1 A G 11: 34,813,477 S510P possibly damaging Het
Tbxa2r G T 10: 81,334,706 *342L probably null Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Tmem52b A G 6: 129,513,003 probably benign Het
Tsc1 T C 2: 28,681,948 F844L probably damaging Het
Ttc39a A G 4: 109,426,347 N158S probably benign Het
Ulk4 C T 9: 121,263,668 E168K possibly damaging Het
Vgf T C 5: 137,032,031 L349P unknown Het
Vil1 T C 1: 74,428,136 Y681H probably damaging Het
Zfp654 A G 16: 64,783,271 *572R probably null Het
Other mutations in Htr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Htr3a APN 9 48904627 missense probably damaging 0.99
R0238:Htr3a UTSW 9 48906386 missense probably benign 0.06
R0238:Htr3a UTSW 9 48906386 missense probably benign 0.06
R0403:Htr3a UTSW 9 48908659 missense probably damaging 0.96
R0899:Htr3a UTSW 9 48901452 missense possibly damaging 0.78
R1749:Htr3a UTSW 9 48900933 missense probably damaging 1.00
R1903:Htr3a UTSW 9 48906381 missense probably damaging 1.00
R1942:Htr3a UTSW 9 48908611 missense probably damaging 1.00
R2218:Htr3a UTSW 9 48908611 missense probably damaging 1.00
R2394:Htr3a UTSW 9 48906343 missense probably benign 0.29
R2402:Htr3a UTSW 9 48901495 missense probably damaging 1.00
R3430:Htr3a UTSW 9 48907388 missense probably benign 0.35
R6042:Htr3a UTSW 9 48904699 missense probably damaging 0.99
R6395:Htr3a UTSW 9 48900571 missense probably benign 0.00
R6407:Htr3a UTSW 9 48901055 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAAGGGGCTGCTATGTCCTTC -3'
(R):5'- GGCTGAGGAAACCCAATCTG -3'

Sequencing Primer
(F):5'- GCTTCACTGTGCTACCCCAAG -3'
(R):5'- CCCAATCTGAGAGTTAAGGGC -3'
Posted On2019-11-26