Incidental Mutation 'R7798:1700088E04Rik'
ID600392
Institutional Source Beutler Lab
Gene Symbol 1700088E04Rik
Ensembl Gene ENSMUSG00000033029
Gene NameRIKEN cDNA 1700088E04 gene
SynonymsMus EST J0827E04
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7798 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location79129349-79141253 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79135732 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 128 (N128I)
Ref Sequence ENSEMBL: ENSMUSP00000129244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040320] [ENSMUST00000169604] [ENSMUST00000186053] [ENSMUST00000186459] [ENSMUST00000187550] [ENSMUST00000188562] [ENSMUST00000189761] [ENSMUST00000190509] [ENSMUST00000190730] [ENSMUST00000190959] [ENSMUST00000229031]
Predicted Effect probably benign
Transcript: ENSMUST00000040320
SMART Domains Protein: ENSMUSP00000042053
Gene: ENSMUSG00000033039

DomainStartEndE-ValueType
CH 4 103 5.64e-19 SMART
low complexity region 113 135 N/A INTRINSIC
LIM 164 219 1.15e-5 SMART
low complexity region 241 250 N/A INTRINSIC
low complexity region 375 394 N/A INTRINSIC
low complexity region 414 467 N/A INTRINSIC
low complexity region 477 497 N/A INTRINSIC
low complexity region 515 530 N/A INTRINSIC
low complexity region 571 586 N/A INTRINSIC
DUF3585 685 825 5.07e-68 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169604
AA Change: N128I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129244
Gene: ENSMUSG00000033029
AA Change: N128I

DomainStartEndE-ValueType
Pfam:UPF0193 4 213 3.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186053
SMART Domains Protein: ENSMUSP00000140261
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 58 3.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186459
SMART Domains Protein: ENSMUSP00000139974
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 54 5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187550
AA Change: N67I

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140978
Gene: ENSMUSG00000033029
AA Change: N67I

DomainStartEndE-ValueType
Pfam:UPF0193 1 57 2.1e-22 PFAM
Pfam:UPF0193 54 155 8.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188562
Predicted Effect probably benign
Transcript: ENSMUST00000189761
SMART Domains Protein: ENSMUSP00000139736
Gene: ENSMUSG00000033029

DomainStartEndE-ValueType
Pfam:UPF0193 1 39 4.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190400
Predicted Effect probably damaging
Transcript: ENSMUST00000190509
AA Change: N107I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140611
Gene: ENSMUSG00000033029
AA Change: N107I

DomainStartEndE-ValueType
Pfam:UPF0193 33 195 4.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190730
AA Change: N67I

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139884
Gene: ENSMUSG00000033029
AA Change: N67I

DomainStartEndE-ValueType
Pfam:UPF0193 1 57 2.1e-22 PFAM
Pfam:UPF0193 54 155 8.3e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190959
AA Change: N128I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140347
Gene: ENSMUSG00000033029
AA Change: N128I

DomainStartEndE-ValueType
Pfam:UPF0193 1 216 1.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191006
Predicted Effect probably benign
Transcript: ENSMUST00000229031
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830473C10Rik T C 5: 90,597,511 S608P possibly damaging Het
Abca13 A G 11: 9,291,664 T1176A probably benign Het
Abca9 A G 11: 110,138,179 V851A probably benign Het
Abcc6 C A 7: 45,976,853 E1494* probably null Het
Adamts14 A T 10: 61,271,173 V56E probably damaging Het
Adamts15 G A 9: 30,904,643 T639M probably damaging Het
Arhgap11a A C 2: 113,843,335 V70G probably damaging Het
BC051665 A T 13: 60,784,435 D113E probably benign Het
Best1 T C 19: 9,991,671 Y227C probably damaging Het
Camk2b A G 11: 5,978,399 S447P probably benign Het
Ccdc88a C A 11: 29,477,348 Q1018K probably benign Het
Cfap74 T A 4: 155,422,622 V180D Het
Clca3a1 T A 3: 144,757,962 T185S probably damaging Het
Clca3b T C 3: 144,828,130 S495G probably damaging Het
Cyb5r2 A T 7: 107,753,948 Y96N possibly damaging Het
Cyp21a1 T C 17: 34,804,321 K27E probably benign Het
Cyp2ab1 T C 16: 20,312,416 E321G probably benign Het
Des T C 1: 75,362,359 I228T probably damaging Het
Dis3l G T 9: 64,341,017 P39T probably benign Het
Disp2 A C 2: 118,791,879 I1031L probably benign Het
Ell3 TCTCCTC TCTC 2: 121,439,456 probably benign Het
Etl4 G A 2: 20,781,946 probably null Het
Fgf23 A T 6: 127,073,214 D62V probably damaging Het
Galnt15 C T 14: 32,029,905 T138I possibly damaging Het
Ggt6 A T 11: 72,435,541 probably benign Het
Gm28710 T C 5: 16,856,658 F801L possibly damaging Het
Gm9573 C G 17: 35,621,254 G680A unknown Het
Gpr180 T A 14: 118,153,686 V209D probably damaging Het
Gzma A T 13: 113,096,324 F78Y probably benign Het
Igkv8-30 A T 6: 70,117,371 C19S probably benign Het
Il1r1 G A 1: 40,310,366 V361I probably benign Het
Intu T C 3: 40,691,929 V598A probably damaging Het
Itpr2 A G 6: 146,386,015 F471L probably benign Het
Kntc1 T A 5: 123,786,294 V1081E probably benign Het
Kntc1 T A 5: 123,819,117 V2163E possibly damaging Het
Macf1 T C 4: 123,378,100 K6552E probably damaging Het
Marf1 T C 16: 14,138,451 H842R probably benign Het
Mgat4b A G 11: 50,225,670 T10A possibly damaging Het
Muc5ac T C 7: 141,794,041 probably null Het
Nrk CGCAGCAGCAGCAGCAGCAGC CGCAGCAGCAGCAGCAGC X: 138,982,677 probably benign Het
Nsun4 T G 4: 116,051,174 S730R possibly damaging Het
Olfr1112 A T 2: 87,192,292 I202L probably benign Het
Olfr1310 A G 2: 112,008,272 F305L probably benign Het
Olfr351 T C 2: 36,860,336 E4G probably benign Het
Olfr360 A T 2: 37,069,174 S290C probably damaging Het
Olfr727 A T 14: 50,127,438 Y287F probably damaging Het
Padi3 C T 4: 140,786,439 E653K probably benign Het
Pde4a A G 9: 21,198,663 E280G possibly damaging Het
Phactr3 G A 2: 178,283,910 R326H probably benign Het
Prob1 G A 18: 35,653,344 P619L possibly damaging Het
Ptk2 G A 15: 73,295,375 R368W probably damaging Het
Rgs6 A G 12: 83,069,519 T240A probably benign Het
Rpa1 A T 11: 75,312,809 Y356N probably damaging Het
Rxrb T A 17: 34,033,605 D165E probably damaging Het
Sco1 A G 11: 67,053,802 T84A possibly damaging Het
Sepsecs T C 5: 52,647,189 I380V probably benign Het
Sfmbt1 T A 14: 30,816,802 W793R probably damaging Het
Slco3a1 A G 7: 74,318,596 S459P probably benign Het
Smg1 A T 7: 118,171,939 S1503R possibly damaging Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Spty2d1 G A 7: 46,996,056 S613F probably damaging Het
Stab2 A T 10: 86,957,912 Y440N probably damaging Het
Syn3 A G 10: 86,080,253 Y290H probably damaging Het
Tex15 C T 8: 33,581,847 S2474F possibly damaging Het
Tgtp1 A G 11: 48,987,332 F182S probably benign Het
Tmcc1 A T 6: 116,043,578 S304R Het
Tmem130 T G 5: 144,743,770 K275Q probably damaging Het
Tmem9 C A 1: 136,034,189 T174K probably damaging Het
Ttyh3 C T 5: 140,634,783 R233Q probably damaging Het
Twnk T C 19: 45,007,668 M180T probably benign Het
Ube4a A G 9: 44,933,331 V874A probably damaging Het
Ugt2a3 T C 5: 87,327,723 N350S probably damaging Het
Vegfa C T 17: 46,031,835 G19D probably damaging Het
Vmn2r2 C A 3: 64,134,097 C399F possibly damaging Het
Vmn2r65 G T 7: 84,946,322 P385T probably benign Het
Vmn2r65 A G 7: 84,946,984 F164S probably damaging Het
Zcchc6 A T 13: 59,815,575 M323K possibly damaging Het
Other mutations in 1700088E04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:1700088E04Rik APN 15 79139253 missense possibly damaging 0.88
R1127:1700088E04Rik UTSW 15 79135203 missense probably benign 0.36
R2184:1700088E04Rik UTSW 15 79135189 missense probably damaging 1.00
R4832:1700088E04Rik UTSW 15 79135209 missense probably damaging 1.00
R6870:1700088E04Rik UTSW 15 79136408 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCGGTGGGACATGTCTATC -3'
(R):5'- TTCCACTGCTAGCCTAACACG -3'

Sequencing Primer
(F):5'- GTGGGACATGTCTATCAAGCC -3'
(R):5'- GCTAGCCTAACACGCTCTG -3'
Posted On2019-11-26