Incidental Mutation 'R7801:Mfsd4b2'
List |< first << previous [record 25 of 47] next >> last >|
ID600540
Institutional Source Beutler Lab
Gene Symbol Mfsd4b2
Ensembl Gene ENSMUSG00000039339
Gene Namemajor facilitator superfamily domain containing 4B2
Synonyms2010001E11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7801 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location39920382-39926923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39923781 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 42 (M42L)
Ref Sequence ENSEMBL: ENSMUSP00000040384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045526]
Predicted Effect probably benign
Transcript: ENSMUST00000045526
AA Change: M42L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040384
Gene: ENSMUSG00000039339
AA Change: M42L

DomainStartEndE-ValueType
Pfam:MFS_1 1 322 3.9e-11 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Meta Mutation Damage Score 0.0864 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap1 A G 1: 89,630,485 Y165C probably damaging Het
Agbl3 A T 6: 34,839,365 T742S probably benign Het
Arhgef10l T C 4: 140,544,267 T651A probably benign Het
Arsb T A 13: 93,862,327 I381N probably damaging Het
Blzf1 A G 1: 164,295,909 V283A probably benign Het
C130060K24Rik T A 6: 65,441,217 V123D probably damaging Het
Cadps C T 14: 12,489,476 probably null Het
Casz1 A T 4: 148,938,249 T591S probably damaging Het
Ccne2 T C 4: 11,194,079 probably null Het
Chst9 T C 18: 15,452,277 T410A probably benign Het
Ciart G A 3: 95,881,344 P61L probably damaging Het
Fam234a T C 17: 26,218,198 D169G probably benign Het
Fat1 C T 8: 45,042,223 P4116L probably damaging Het
Fbxo21 G T 5: 117,986,124 A166S probably damaging Het
Gbf1 A G 19: 46,272,643 I1216V probably benign Het
Gper1 G A 5: 139,426,688 A263T probably benign Het
Hdlbp G T 1: 93,430,307 probably null Het
Ighg3 A T 12: 113,359,816 L280Q Het
Impa1 T C 3: 10,321,667 T171A probably benign Het
Ints7 T A 1: 191,615,747 Y744N possibly damaging Het
Irgc1 G T 7: 24,432,534 A286D probably damaging Het
Kif18a T C 2: 109,287,845 S2P probably damaging Het
Macf1 A T 4: 123,408,271 W813R probably damaging Het
Mapkbp1 T G 2: 120,012,073 H157Q probably damaging Het
Mon2 A G 10: 123,059,186 probably null Het
Myrfl T A 10: 116,848,335 H161L probably benign Het
Olfr171 T C 16: 19,624,623 H159R probably damaging Het
Olfr832 A C 9: 18,945,259 S204R probably damaging Het
Phlpp2 T G 8: 109,925,842 V606G possibly damaging Het
Psmb5 T C 14: 54,616,755 T89A probably benign Het
Ptpn9 A G 9: 57,061,013 T546A probably benign Het
Rabep2 A G 7: 126,438,412 M146V possibly damaging Het
Rptn G A 3: 93,398,224 E955K possibly damaging Het
Samd3 G T 10: 26,263,872 V301F possibly damaging Het
Sh2b1 C A 7: 126,471,292 C380F probably benign Het
Shank1 A G 7: 44,351,598 M914V unknown Het
Sox2 G A 3: 34,650,642 R76H probably damaging Het
Stat5a T C 11: 100,880,317 F574S probably damaging Het
Tbx5 A G 5: 119,836,999 E29G probably benign Het
Trpm5 A C 7: 143,085,241 D264E probably damaging Het
Zfp442 T C 2: 150,409,719 S88G probably benign Het
Zfp62 T A 11: 49,217,328 F749I possibly damaging Het
Zfp677 T A 17: 21,398,015 S445T probably damaging Het
Zfp979 A C 4: 147,613,978 N91K probably damaging Het
Zfyve9 A G 4: 108,684,995 V209A possibly damaging Het
Zic4 G T 9: 91,384,244 A314S probably benign Het
Other mutations in Mfsd4b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Mfsd4b2 APN 10 39925061 splice site probably benign
IGL01546:Mfsd4b2 APN 10 39921475 missense probably damaging 1.00
IGL01662:Mfsd4b2 APN 10 39922197 splice site probably benign
IGL02151:Mfsd4b2 APN 10 39921691 missense probably damaging 1.00
R1928:Mfsd4b2 UTSW 10 39921462 missense probably damaging 1.00
R2851:Mfsd4b2 UTSW 10 39922123 missense probably benign 0.07
R3777:Mfsd4b2 UTSW 10 39921531 missense possibly damaging 0.54
R5055:Mfsd4b2 UTSW 10 39923777 missense possibly damaging 0.79
R5257:Mfsd4b2 UTSW 10 39922021 missense probably benign 0.00
R5258:Mfsd4b2 UTSW 10 39922021 missense probably benign 0.00
R5563:Mfsd4b2 UTSW 10 39922042 missense probably benign 0.15
R5728:Mfsd4b2 UTSW 10 39923795 missense possibly damaging 0.47
R5888:Mfsd4b2 UTSW 10 39922035 missense probably benign 0.00
R6147:Mfsd4b2 UTSW 10 39921577 missense probably benign
R6362:Mfsd4b2 UTSW 10 39921609 missense probably damaging 1.00
R7462:Mfsd4b2 UTSW 10 39921881 missense probably benign 0.03
R8126:Mfsd4b2 UTSW 10 39921988 missense probably benign
R8158:Mfsd4b2 UTSW 10 39922068 missense probably benign 0.35
Z1176:Mfsd4b2 UTSW 10 39921600 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATACTGGGGTACTGAGGTGC -3'
(R):5'- CCAAGACCAAACAGCTTTAATTCAGTG -3'

Sequencing Primer
(F):5'- AGGTGCTGAAGTGTGATGCTAAG -3'
(R):5'- CTTCTGACCTTCACAAACAC -3'
Posted On2019-11-26