Incidental Mutation 'R7818:Slc18a2'
ID601712
Institutional Source Beutler Lab
Gene Symbol Slc18a2
Ensembl Gene ENSMUSG00000025094
Gene Namesolute carrier family 18 (vesicular monoamine), member 2
SynonymsVmat2, 1110037L13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7818 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location59260878-59296012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 59263161 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 115 (T115P)
Ref Sequence ENSEMBL: ENSMUSP00000026084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026084]
Predicted Effect probably benign
Transcript: ENSMUST00000026084
AA Change: T115P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026084
Gene: ENSMUSG00000025094
AA Change: T115P

DomainStartEndE-ValueType
Pfam:MFS_1 22 428 6.8e-40 PFAM
Pfam:Sugar_tr 26 284 5.9e-10 PFAM
Pfam:MFS_2 127 457 4.3e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The vesicular monoamine transporter acts to accumulate cytosolic monoamines into synaptic vesicles, using the proton gradient maintained across the synaptic vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (summary by Peter et al., 1993 [PubMed 7905859]). See also SLC18A1 (MIM 193002).[supplied by OMIM, Jan 2011]
PHENOTYPE: Nullizygous mice exhibit early postnatal death accompanied by reduced body size, hypokinesia, and reduced brain monoamine levels. Hypomorphic mutants show impaired olfaction, gastroparesis, altered sleep latency, neuron degeneration, enhanced MPTP sensitivity, anxiety- and depressive-like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,304,221 R342S probably benign Het
Aatk C T 11: 120,021,455 V55I probably benign Het
Abhd10 T A 16: 45,737,553 I128L probably benign Het
Abraxas1 T A 5: 100,806,310 M325L probably benign Het
Adgrb2 C A 4: 130,014,560 L1087I probably damaging Het
Adgrb2 C T 4: 130,014,969 P1124S possibly damaging Het
Akap9 T A 5: 4,013,875 Y1741* probably null Het
Ap1g2 A T 14: 55,099,724 V718D probably benign Het
Asph A T 4: 9,475,015 M637K probably damaging Het
Atp2c1 T C 9: 105,414,757 I869V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1e T C 1: 154,398,406 D2251G probably damaging Het
Camk2b A G 11: 5,977,812 S413P probably benign Het
Casz1 G A 4: 148,946,076 C1184Y probably damaging Het
Cbr4 G A 8: 61,487,942 V32I probably benign Het
Ccdc166 A G 15: 75,981,015 S368P possibly damaging Het
Ccdc170 A G 10: 4,549,603 N508S probably benign Het
Ccdc187 A G 2: 26,276,174 S748P possibly damaging Het
Cdca8 A T 4: 124,926,663 probably null Het
Cep120 T C 18: 53,723,103 D414G probably benign Het
Dcp1a G T 14: 30,479,721 A34S probably damaging Het
Ddit3 C T 10: 127,295,793 T70I probably benign Het
Dlg2 C G 7: 91,940,017 A313G probably damaging Het
Dnah9 A T 11: 66,025,211 V2305D possibly damaging Het
Dock1 T A 7: 134,763,865 D427E probably damaging Het
Dolpp1 T C 2: 30,396,491 L141P probably benign Het
Dsc2 A T 18: 20,050,132 D76E probably damaging Het
Dusp7 C A 9: 106,369,130 N111K probably benign Het
Fam193a A G 5: 34,465,653 E1195G possibly damaging Het
Fig4 A G 10: 41,263,166 L347P probably damaging Het
Frem1 T C 4: 83,014,008 E152G probably damaging Het
Galnt2 G T 8: 124,329,788 D234Y probably damaging Het
Hist1h1d C T 13: 23,554,991 probably benign Het
Igkv4-59 T C 6: 69,438,491 T27A possibly damaging Het
Ihh T C 1: 74,946,645 D227G possibly damaging Het
Il1rap T A 16: 26,698,847 C266S probably damaging Het
Iqcf4 A T 9: 106,570,539 L57* probably null Het
Kif2b A G 11: 91,576,126 S444P probably damaging Het
Lmf1 T G 17: 25,662,591 I538S probably benign Het
Mical2 A G 7: 112,345,307 Y948C probably damaging Het
Mr1 G A 1: 155,130,636 Q322* probably null Het
Mroh2a T C 1: 88,234,612 probably null Het
Mup6 A G 4: 60,004,884 T100A probably benign Het
Mybpc1 T A 10: 88,558,667 D266V probably damaging Het
Myocos T C 1: 162,647,494 N48S unknown Het
Naf1 G A 8: 66,889,376 G551E probably damaging Het
Nrarp A G 2: 25,181,238 N43S possibly damaging Het
Olfr1253 A G 2: 89,751,944 S295P possibly damaging Het
Olfr19 A C 16: 16,673,573 M136R probably damaging Het
Olfr472 G A 7: 107,903,023 C102Y probably benign Het
Olfr832 T A 9: 18,945,009 Y120* probably null Het
Olfr983 T A 9: 40,092,712 M85L probably damaging Het
Padi3 T A 4: 140,798,142 T177S possibly damaging Het
Pde3b A G 7: 114,491,440 M305V probably damaging Het
Pde6a T A 18: 61,281,509 probably null Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prph A G 15: 99,057,872 T446A probably damaging Het
Pwwp2b T C 7: 139,255,324 V227A probably benign Het
Rev3l T C 10: 39,823,902 I1465T possibly damaging Het
Rin1 A G 19: 5,052,191 S243G probably benign Het
Ripor3 A T 2: 167,989,426 I485N probably benign Het
Rnpc3 G T 3: 113,629,951 P35Q probably damaging Het
Sbpl G T 17: 23,953,262 Q228K unknown Het
Scn11a A C 9: 119,784,111 N804K probably damaging Het
Selenoo A G 15: 89,096,816 T453A probably damaging Het
Sez6 C T 11: 77,976,902 P882S probably damaging Het
Skint5 C T 4: 113,942,726 R82H possibly damaging Het
Slc1a2 A G 2: 102,743,956 D237G probably benign Het
Spidr T C 16: 16,114,865 S184G probably damaging Het
Stag3 A T 5: 138,301,443 Q872L probably benign Het
Suds3 T C 5: 117,115,749 probably benign Het
Sv2c T A 13: 95,986,820 K382* probably null Het
Taf2 T C 15: 55,065,930 I77V probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tdrd3 G T 14: 87,472,200 C100F probably damaging Het
Tek T A 4: 94,827,716 H458Q possibly damaging Het
Tes C A 6: 17,099,744 P246Q probably damaging Het
Tgif1 A T 17: 70,849,608 probably null Het
Tlr11 A T 14: 50,361,828 N424Y probably damaging Het
Tmc8 A T 11: 117,792,127 N626I probably damaging Het
Tmem132c T A 5: 127,564,088 *1108K probably null Het
Tnks A T 8: 34,873,028 Y479N probably benign Het
Trip12 C T 1: 84,760,806 G776D probably damaging Het
Tssk1 A G 16: 17,894,447 E32G probably benign Het
Ube2o T C 11: 116,543,910 D575G probably damaging Het
Uckl1 A T 2: 181,574,667 M16K probably damaging Het
Zfp948 A T 17: 21,587,723 E392D probably benign Het
Zmynd8 G A 2: 165,842,831 T167I probably damaging Het
Other mutations in Slc18a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Slc18a2 APN 19 59284384 missense probably benign 0.02
IGL01956:Slc18a2 APN 19 59287176 splice site probably benign
IGL02220:Slc18a2 APN 19 59276556 missense probably benign 0.01
IGL02389:Slc18a2 APN 19 59263301 splice site probably benign
IGL02795:Slc18a2 APN 19 59274490 splice site probably benign
PIT4585001:Slc18a2 UTSW 19 59293861 missense possibly damaging 0.47
R0373:Slc18a2 UTSW 19 59287367 missense probably benign
R1972:Slc18a2 UTSW 19 59274653 missense possibly damaging 0.89
R2018:Slc18a2 UTSW 19 59276505 missense possibly damaging 0.90
R3508:Slc18a2 UTSW 19 59273557 missense probably benign 0.03
R5313:Slc18a2 UTSW 19 59293843 missense probably benign 0.04
R5574:Slc18a2 UTSW 19 59261405 missense probably benign 0.09
R6102:Slc18a2 UTSW 19 59293878 missense probably benign 0.00
R7569:Slc18a2 UTSW 19 59284152 missense probably damaging 0.96
R7607:Slc18a2 UTSW 19 59284358 missense probably benign 0.43
R8059:Slc18a2 UTSW 19 59284140 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATTCCCAGCTACCTGTACAGC -3'
(R):5'- TGACTGATGAGCAAGCAGC -3'

Sequencing Primer
(F):5'- TTCCCAGCTACCTGTACAGCATTAAG -3'
(R):5'- CTGATGAGCAAGCAGCAGGATAC -3'
Posted On2019-12-03