Incidental Mutation 'RF031:Zfp335'
ID604354
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #RF031 (G1)
Quality Score206.468
Status Not validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) TCGTCGTC to TCGTCGTCGTC at 164907463 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000139247] [ENSMUST00000183830]
Predicted Effect probably benign
Transcript: ENSMUST00000041361
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139247
SMART Domains Protein: ENSMUSP00000138664
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI837181 GCG GCGCCG 19: 5,425,218 probably benign Het
Blm CTCCTCCTCCTCCTCCTCCTCCTC CTCCTCCTCCTCTTCCTCCTCCTCCTCCTCCTCCTC 7: 80,512,906 probably benign Het
Blm CCTCCTCCTCC CCTCCTCCTCCTGCTCCTCCTCC 7: 80,512,923 probably benign Het
Cyb5r4 GGGA GGGATGTGACAGACACACTGCCCATGGA 9: 87,040,445 probably benign Het
Dcdc2b GCTGC GCTGCCAGGACTGC 4: 129,609,651 probably benign Het
Dclre1a CTTTGCT C 19: 56,544,132 probably benign Het
Dctn6 AAATCATGGCTTGCGATCT A 8: 34,105,082 probably null Het
Elovl5 G T 9: 77,981,473 probably null Het
Ermn AACT AACTACT 2: 58,048,066 probably benign Het
Fbrsl1 G GCGTGTGCTGGTC 5: 110,378,151 probably benign Het
Fgd6 ATT A 10: 94,044,325 probably null Het
Flywch1 TCACTCACCCACTCCTGGTGT TCACTCACCCACTCCTGGTGTGGGGAGGCTACGCACTCACCCACTCCTGGTGT 17: 23,762,158 probably null Het
Gab3 TCT TCTGCT X: 74,999,996 probably benign Het
Gab3 CTT CTTATT X: 74,999,997 probably null Het
Gab3 TTC TTCATC X: 75,000,001 probably benign Het
Gm11060 CTGTGTG CTG 2: 105,092,040 probably null Het
Gm5475 GGTGGAAGGAAAG GG 15: 100,427,148 probably null Het
Heatr3 TAT TATTAAT 8: 88,156,457 probably benign Het
Iqcf4 TTTCCTTTT TTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTCTTCCTTTT 9: 106,570,615 probably benign Het
Ivl GCTGCTGCTGCTGC G 3: 92,572,318 probably null Het
Kif12 GGC GGCCTCCACCCGGCGTGC 4: 63,171,425 probably benign Het
L1td1 AGGAGGAGGAGGAGGAGGAGGAGGGGGAGGAGGAG AGGAGGAGGAG 4: 98,736,789 probably benign Het
Lca5l CCCTGGCCCCGGCC CCC 16: 96,159,304 probably null Het
Lor ATAGCCG A 3: 92,081,876 probably benign Het
Mapk7 GGGGCA GGGGCACGGGCA 11: 61,490,234 probably benign Het
Nf2 AAAAG A 11: 4,829,936 probably null Het
Nlrp3 GGGTA G 11: 59,558,552 probably null Het
Nolc1 CAGCAGC CAGCAGCAGGAGCAGC 19: 46,081,371 probably benign Het
Pdik1l TTTT TTTTGTTTTTGATTT 4: 134,279,374 probably null Het
Phldb3 CGCCCCCG C 7: 24,626,493 probably null Het
Setd1a GGTGGTAGT GGTGGTAGTAGTGGTAGT 7: 127,785,311 probably benign Het
Strn CTTACCCCAGTC CTTACCCCAGTCCGTGCTCCCTTACCCCAGTCCGTGATCCATTACCCCAGTC 17: 78,677,277 probably null Het
Tcof1 TTCCCAGAGATCCCCTTGGC TTCCCAGAGATCCCCTTGGCTGCTGAGATGGGCACTATCCCAGAGATCCCCTTGGC 18: 60,833,565 probably benign Het
Tcof1 AGC AGCGGC 18: 60,835,745 probably benign Het
Tedc2 AGGAACCCT AGGAACCCTGGAACCCT 17: 24,216,239 probably benign Het
Thegl CCCCAGTCCCGCAAGGCCAG CCCCAGTCCCGCAAGGCCAGCGATCCTACCCAGTCCCGCAAGGCCAG 5: 77,016,410 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Zfhx3 C CCGCAGCAAA 8: 108,956,098 probably benign Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
PIT4403001:Zfp335 UTSW 2 164893716 missense possibly damaging 0.56
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
R7174:Zfp335 UTSW 2 164902503 missense probably damaging 1.00
R7185:Zfp335 UTSW 2 164893244 critical splice donor site probably null
R7296:Zfp335 UTSW 2 164900132 missense probably damaging 0.99
R7322:Zfp335 UTSW 2 164910821 start codon destroyed probably null 0.90
R7504:Zfp335 UTSW 2 164909418 missense probably benign 0.27
R7560:Zfp335 UTSW 2 164895992 missense probably damaging 1.00
R7637:Zfp335 UTSW 2 164892539 critical splice donor site probably null
R8064:Zfp335 UTSW 2 164907700 missense probably damaging 1.00
R8208:Zfp335 UTSW 2 164893616 critical splice acceptor site probably null
R8228:Zfp335 UTSW 2 164904898 missense probably damaging 1.00
R8271:Zfp335 UTSW 2 164898053 missense probably damaging 0.98
R8688:Zfp335 UTSW 2 164892193 missense probably damaging 1.00
R8803:Zfp335 UTSW 2 164909370 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGCATTGAGAAGTGCGTGTATC -3'
(R):5'- GTGCAACAGTTCAAGTGCAAG -3'

Sequencing Primer
(F):5'- AGAAGTGCGTGTATCTTTTCGC -3'
(R):5'- CAAGATGTGCCAGTACCGG -3'
Posted On2019-12-04