Mutagenetix > Incidental Mutations

Incidental Mutation 'R7296:Zfp335'

571602

Institutional Source

Beutler Lab

Gene Symbol

Zfp335

Ensembl Gene

ENSMUSG00000039834

Gene Name

zinc finger protein 335

Synonyms

1810045J01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7296 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

164891882-164911757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 164900132 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 614 (I614T)

Ref Sequence

ENSEMBL: ENSMUSP00000038298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000139247] [ENSMUST00000183830]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041361
AA Change: I614T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: I614T

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	63	N/A	INTRINSIC
ZnF_C2H2	248	271	4.24e-4	SMART
low complexity region	275	282	N/A	INTRINSIC
low complexity region	300	321	N/A	INTRINSIC
low complexity region	340	365	N/A	INTRINSIC
low complexity region	435	445	N/A	INTRINSIC
ZnF_C2H2	466	488	2.17e-1	SMART
ZnF_C2H2	496	518	1.56e-2	SMART
ZnF_C2H2	524	546	8.81e-2	SMART
ZnF_C2H2	563	585	2.79e-4	SMART
ZnF_C2H2	591	613	2.53e-2	SMART
ZnF_C2H2	622	644	6.78e-3	SMART
ZnF_C2H2	650	673	8.22e-2	SMART
ZnF_C2H2	679	702	3.29e-1	SMART
low complexity region	711	726	N/A	INTRINSIC
internal_repeat_3	770	937	7.16e-5	PROSPERO
low complexity region	1005	1015	N/A	INTRINSIC
ZnF_C2H2	1019	1041	2.95e-3	SMART
ZnF_C2H2	1047	1069	5.5e-3	SMART
ZnF_C2H2	1075	1097	1.58e-3	SMART
ZnF_C2H2	1103	1126	3.34e-2	SMART
low complexity region	1288	1305	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139247

SMART Domains

Protein: ENSMUSP00000138664
Gene: ENSMUSG00000039834

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
low complexity region	30	51	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000183830

SMART Domains

Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

Domain	Start	End	E-Value	Type
low complexity region	31	45	N/A	INTRINSIC
low complexity region	52	63	N/A	INTRINSIC
ZnF_C2H2	248	271	4.24e-4	SMART
low complexity region	275	282	N/A	INTRINSIC
low complexity region	300	321	N/A	INTRINSIC
low complexity region	340	365	N/A	INTRINSIC
low complexity region	435	445	N/A	INTRINSIC
ZnF_C2H2	466	488	2.17e-1	SMART
ZnF_C2H2	496	518	1.56e-2	SMART
ZnF_C2H2	524	546	8.81e-2	SMART
ZnF_C2H2	563	585	2.79e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

98% (85/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700066M21Rik	T	A	1: 57,383,143	M226K	probably benign	Het
2010300C02Rik	T	C	1: 37,614,618	T1036A	possibly damaging	Het
4921524L21Rik	T	G	18: 6,626,385	S132R	probably damaging	Het
A4gnt	T	G	9: 99,620,282	I165S	probably damaging	Het
Abca14	G	A	7: 120,278,311	D1061N	probably benign	Het
Abcc9	G	A	6: 142,671,593	P582S	probably damaging	Het
Abhd5	G	A	9: 122,379,573	V343I	probably benign	Het
Adam6a	C	T	12: 113,545,572	R522C	probably damaging	Het
Ankle2	G	A	5: 110,237,724	R313H	probably damaging	Het
Aplf	G	A	6: 87,646,215	T315I	probably damaging	Het
Arntl2	G	A	6: 146,822,134	V321I	not run	Het
Asic5	C	T	3: 82,021,076	P491S	probably benign	Het
Atp5b	T	C	10: 128,085,522	Y230H	probably benign	Het
B4galt6	A	T	18: 20,728,042	I51N	probably damaging	Het
C4b	A	G	17: 34,743,659	L23S	probably damaging	Het
C77080	A	G	4: 129,225,418	Y170H	probably damaging	Het
Cables2	A	G	2: 180,260,336	V410A		Het
Cdyl	A	G	13: 35,863,395	M489V	probably damaging	Het
Clip4	T	C	17: 71,790,001	M40T	probably damaging	Het
Col12a1	T	C	9: 79,682,066	Y1069C	probably damaging	Het
Col6a3	T	C	1: 90,827,986	M194V	probably benign	Het
Colec11	T	A	12: 28,594,715	D260V	probably damaging	Het
Cux2	T	C	5: 121,861,256	D1207G	probably benign	Het
Cyp2d34	G	T	15: 82,617,235	N297K	possibly damaging	Het
Dmbt1	A	G	7: 131,112,132	Y1643C	unknown	Het
Dnmt3c	A	G	2: 153,715,026	T288A	probably benign	Het
Dock8	T	A	19: 25,184,881	F1842I	probably benign	Het
Dysf	A	G	6: 84,106,898	I740V	probably benign	Het
Epha6	T	A	16: 59,915,838	M778L	probably benign	Het
Eri2	A	T	7: 119,786,516	L254*	probably null	Het
Fam129b	T	C	2: 32,922,642	S468P	possibly damaging	Het
Fam43b	A	G	4: 138,395,841	F56S	probably damaging	Het
Fat4	C	A	3: 38,889,145	S729*	probably null	Het
Fbxw22	C	A	9: 109,382,075	W386L	probably benign	Het
Fgd6	T	A	10: 94,044,047	C254*	probably null	Het
Fgd6	C	A	10: 94,139,881	T1386K	probably benign	Het
Fkbp7	G	T	2: 76,671,764	D98E	possibly damaging	Het
Gm8251	T	A	1: 44,060,916	K341*	probably null	Het
Hectd1	C	T	12: 51,785,852	C913Y	possibly damaging	Het
Hgf	T	A	5: 16,564,843	M105K	probably benign	Het
Icam1	A	C	9: 21,019,015	D55A	probably benign	Het
Itga2	A	C	13: 114,857,394		probably null	Het
Kcnj5	A	C	9: 32,322,749	L90R	probably damaging	Het
Klra17	T	A	6: 129,831,592	N226I	possibly damaging	Het
Krt1	T	A	15: 101,850,629	R33S	unknown	Het
L3mbtl3	T	A	10: 26,282,830	D615V	unknown	Het
Lrp2	T	A	2: 69,482,381	Y2521F	probably benign	Het
Megf10	A	T	18: 57,275,753	N589I	probably damaging	Het
Metap1d	G	C	2: 71,506,785	G14A	probably benign	Het
Mfap5	T	A	6: 122,528,422	D162E	probably benign	Het
Mixl1	T	C	1: 180,696,958	I19V	probably benign	Het
Mtrr	G	T	13: 68,568,860	Y411*	probably null	Het
Myh7	T	C	14: 54,990,025	T318A	probably benign	Het
Nbeal1	T	A	1: 60,310,224	Y2348*	probably null	Het
Nlrc3	T	C	16: 3,963,590	S668G	probably damaging	Het
Nutm1	G	A	2: 112,250,056	R505C	probably damaging	Het
Olfr1129	T	A	2: 87,575,708	V208E	probably damaging	Het
Olfr1222	C	A	2: 89,124,836	R298S	probably benign	Het
Olfr527	A	T	7: 140,336,741	D293V	possibly damaging	Het
Pcna	A	G	2: 132,252,877	S54P	probably benign	Het
Pde6a	A	G	18: 61,258,293	T570A	probably damaging	Het
Phf21b	A	T	15: 84,855,717	M1K	probably null	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Prob1	A	G	18: 35,653,299	F634S	possibly damaging	Het
Prss50	A	G	9: 110,861,289	T167A	probably damaging	Het
Ptpn1	T	C	2: 167,974,772	V249A	probably damaging	Het
Rai1	G	A	11: 60,188,673	V1188I	probably benign	Het
Ric1	G	A	19: 29,584,578		probably null	Het
Robo1	C	T	16: 72,989,631	Q844*	probably null	Het
Rpn1	A	G	6: 88,084,637	D36G	possibly damaging	Het
Serpinb1b	A	T	13: 33,093,827	M348L	probably benign	Het
Setd4	T	C	16: 93,583,942		probably null	Het
Setd5	T	G	6: 113,147,557	S1124A	probably benign	Het
Slc35c1	C	A	2: 92,458,739	V154F	probably damaging	Het
Slc7a6os	G	T	8: 106,210,489	S113*	probably null	Het
Syne2	T	A	12: 76,103,036	D1787E	probably benign	Het
Tas2r144	A	C	6: 42,215,439	I38L	probably damaging	Het
Tepsin	G	T	11: 120,091,708	T512K	possibly damaging	Het
Utp20	A	G	10: 88,770,724	V1662A	probably benign	Het
Vmn1r201	C	T	13: 22,475,339	A241V	possibly damaging	Het
Vmn2r60	T	A	7: 42,136,402	S210T	probably benign	Het
Wdr6	G	T	9: 108,574,585	H700N	probably damaging	Het
Zdhhc8	T	C	16: 18,234,926	T29A	probably benign	Het
Zfp54	T	A	17: 21,433,582	S113T	probably benign	Het
Zfp873	T	A	10: 82,061,237	C601S	probably damaging	Het
Zfyve26	T	C	12: 79,278,372		probably null	Het
Zmynd8	T	C	2: 165,840,009	T201A	probably damaging	Het

Other mutations in Zfp335

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Zfp335	APN	2	164892382	missense	probably damaging	1.00
IGL00921:Zfp335	APN	2	164894776	missense	possibly damaging	0.51
IGL00980:Zfp335	APN	2	164902674	nonsense	probably null
IGL01145:Zfp335	APN	2	164907502	missense	probably benign	0.03
IGL01568:Zfp335	APN	2	164894788	missense	possibly damaging	0.70
IGL01612:Zfp335	APN	2	164910620	critical splice donor site	probably null
IGL02138:Zfp335	APN	2	164893804	missense	probably damaging	1.00
IGL02675:Zfp335	APN	2	164910689	missense	probably benign
IGL03206:Zfp335	APN	2	164892681	splice site	probably benign
IGL03269:Zfp335	APN	2	164900354	missense	probably damaging	1.00
IGL03306:Zfp335	APN	2	164895984	splice site	probably benign
FR4342:Zfp335	UTSW	2	164907465	small insertion	probably benign
FR4342:Zfp335	UTSW	2	164907477	small insertion	probably benign
FR4449:Zfp335	UTSW	2	164907477	small insertion	probably benign
FR4449:Zfp335	UTSW	2	164907483	small insertion	probably benign
FR4548:Zfp335	UTSW	2	164907472	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907474	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907475	small insertion	probably benign
FR4737:Zfp335	UTSW	2	164907484	small insertion	probably benign
FR4976:Zfp335	UTSW	2	164907474	small insertion	probably benign
FR4976:Zfp335	UTSW	2	164907478	small insertion	probably benign
PIT4403001:Zfp335	UTSW	2	164893716	missense	possibly damaging	0.56
R0005:Zfp335	UTSW	2	164909302	missense	possibly damaging	0.91
R0101:Zfp335	UTSW	2	164899990	missense	probably damaging	1.00
R0196:Zfp335	UTSW	2	164896145	missense	possibly damaging	0.88
R0211:Zfp335	UTSW	2	164907692	missense	probably damaging	1.00
R0211:Zfp335	UTSW	2	164907692	missense	probably damaging	1.00
R0533:Zfp335	UTSW	2	164907922	nonsense	probably null
R0865:Zfp335	UTSW	2	164899495	splice site	probably null
R1023:Zfp335	UTSW	2	164892585	missense	possibly damaging	0.88
R1029:Zfp335	UTSW	2	164892678	splice site	probably benign
R1052:Zfp335	UTSW	2	164907468	small deletion	probably benign
R1106:Zfp335	UTSW	2	164907551	small deletion	probably benign
R1146:Zfp335	UTSW	2	164896123	missense	probably benign	0.01
R1146:Zfp335	UTSW	2	164896123	missense	probably benign	0.01
R1274:Zfp335	UTSW	2	164907468	small deletion	probably benign
R1386:Zfp335	UTSW	2	164898241	missense	probably benign	0.00
R1433:Zfp335	UTSW	2	164899456	missense	probably damaging	0.99
R1813:Zfp335	UTSW	2	164892605	missense	probably damaging	0.99
R1959:Zfp335	UTSW	2	164894802	missense	probably damaging	1.00
R2372:Zfp335	UTSW	2	164895039	missense	probably damaging	1.00
R3847:Zfp335	UTSW	2	164900106	splice site	probably null
R3937:Zfp335	UTSW	2	164910700	missense	probably damaging	1.00
R3946:Zfp335	UTSW	2	164892189	missense	probably damaging	1.00
R3979:Zfp335	UTSW	2	164910638	missense	probably benign	0.00
R4019:Zfp335	UTSW	2	164901460	missense	probably damaging	1.00
R4020:Zfp335	UTSW	2	164901460	missense	probably damaging	1.00
R4668:Zfp335	UTSW	2	164900286	missense	probably damaging	1.00
R5000:Zfp335	UTSW	2	164894668	missense	probably benign
R5038:Zfp335	UTSW	2	164910644	nonsense	probably null
R5245:Zfp335	UTSW	2	164894758	missense	probably benign
R5411:Zfp335	UTSW	2	164902245	missense	probably damaging	0.99
R5422:Zfp335	UTSW	2	164907730	missense	probably damaging	1.00
R5968:Zfp335	UTSW	2	164892394	missense	probably damaging	0.99
R6056:Zfp335	UTSW	2	164895098	splice site	probably null
R6551:Zfp335	UTSW	2	164909365	missense	probably benign
R6927:Zfp335	UTSW	2	164893720	missense	probably damaging	1.00
R6943:Zfp335	UTSW	2	164894875	missense	possibly damaging	0.50
R6995:Zfp335	UTSW	2	164893290	nonsense	probably null
R7174:Zfp335	UTSW	2	164902503	missense	probably damaging	1.00
R7185:Zfp335	UTSW	2	164893244	critical splice donor site	probably null
R7322:Zfp335	UTSW	2	164910821	start codon destroyed	probably null	0.90
R7504:Zfp335	UTSW	2	164909418	missense	probably benign	0.27
R7560:Zfp335	UTSW	2	164895992	missense	probably damaging	1.00
R7637:Zfp335	UTSW	2	164892539	critical splice donor site	probably null
R8064:Zfp335	UTSW	2	164907700	missense	probably damaging	1.00
R8208:Zfp335	UTSW	2	164893616	critical splice acceptor site	probably null
R8228:Zfp335	UTSW	2	164904898	missense	probably damaging	1.00
R8271:Zfp335	UTSW	2	164898053	missense	probably damaging	0.98
R8688:Zfp335	UTSW	2	164892193	missense	probably damaging	1.00
R8803:Zfp335	UTSW	2	164909370	missense	probably benign	0.14
RF031:Zfp335	UTSW	2	164907463	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- GCATTTGAAGGGCTTGTCGC -3'
(R):5'- TGTCTACCCCATGCAGAAGAGG -3'

Sequencing Primer
(F):5'- TCGCTCACGTGGGACAGTTG -3'
(R):5'- TGAAGACTCACAGCACCGAG -3'

Posted On

2019-09-13