Incidental Mutation 'R7858:Ccny'
ID607348
Institutional Source Beutler Lab
Gene Symbol Ccny
Ensembl Gene ENSMUSG00000024286
Gene Namecyclin Y
Synonyms5730405I09Rik, 4631402G10Rik, 1700025H17Rik, 3110050L10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R7858 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location9314044-9450150 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9386782 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 61 (D61V)
Ref Sequence ENSEMBL: ENSMUSP00000050001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053917]
Predicted Effect probably damaging
Transcript: ENSMUST00000053917
AA Change: D61V

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050001
Gene: ENSMUSG00000024286
AA Change: D61V

DomainStartEndE-ValueType
CYCLIN 173 258 1.36e-7 SMART
Meta Mutation Damage Score 0.1545 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cyclins, such as CCNY, control cell division cycles and regulate cyclin-dependent kinases (e.g., CDC2; MIM 116940) (Li et al., 2009 [PubMed 18060517]).[supplied by OMIM, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired adipogenesis and lipid production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Zfp961 T C 8: 71,951,105 V4A unknown Het
Other mutations in Ccny
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Ccny APN 18 9345444 missense probably benign 0.18
IGL01986:Ccny APN 18 9377817 missense probably damaging 1.00
IGL03000:Ccny APN 18 9353489 missense probably benign 0.12
IGL03257:Ccny APN 18 9386747 missense possibly damaging 0.84
R0015:Ccny UTSW 18 9316682 splice site probably benign
R0015:Ccny UTSW 18 9316682 splice site probably benign
R0372:Ccny UTSW 18 9345201 missense probably damaging 1.00
R0440:Ccny UTSW 18 9332917 missense probably benign 0.21
R1645:Ccny UTSW 18 9345199 missense probably damaging 0.99
R2044:Ccny UTSW 18 9449644 missense probably damaging 1.00
R2405:Ccny UTSW 18 9353480 missense probably benign 0.08
R3847:Ccny UTSW 18 9449641 missense probably benign 0.37
R3864:Ccny UTSW 18 9449604 missense probably damaging 1.00
R4198:Ccny UTSW 18 9332928 missense probably damaging 0.96
R4964:Ccny UTSW 18 9449516 critical splice donor site probably null
R6474:Ccny UTSW 18 9345427 missense probably damaging 1.00
X0050:Ccny UTSW 18 9332874 missense possibly damaging 0.87
Z1177:Ccny UTSW 18 9353494 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACCATTACACACAGTACTTCATGG -3'
(R):5'- GCTCACCTGTGGAACATATCAG -3'

Sequencing Primer
(F):5'- CACAGTACTTCATGGTCACTAAAGGG -3'
(R):5'- CACCTGTGGAACATATCAGATATGG -3'
Posted On2019-12-20