Incidental Mutation 'R7858:Zfp961'
ID607336
Institutional Source Beutler Lab
Gene Symbol Zfp961
Ensembl Gene ENSMUSG00000052446
Gene Namezinc finger protein 961
SynonymsA230105L22Rik, BC049349
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7858 (G1)
Quality Score165.009
Status Validated
Chromosome8
Chromosomal Location71951038-71993792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71951105 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 4 (V4A)
Ref Sequence ENSEMBL: ENSMUSP00000105623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109997] [ENSMUST00000131237] [ENSMUST00000132848] [ENSMUST00000136516] [ENSMUST00000138304] [ENSMUST00000145256]
Predicted Effect unknown
Transcript: ENSMUST00000109997
AA Change: V4A
SMART Domains Protein: ENSMUSP00000105623
Gene: ENSMUSG00000052446
AA Change: V4A

DomainStartEndE-ValueType
KRAB 25 82 1.14e-18 SMART
ZnF_C2H2 144 166 1.69e-3 SMART
ZnF_C2H2 172 194 3.07e-1 SMART
ZnF_C2H2 199 221 1.36e-2 SMART
ZnF_C2H2 226 248 3.29e-1 SMART
ZnF_C2H2 254 276 3.34e-2 SMART
ZnF_C2H2 282 304 9.58e-3 SMART
ZnF_C2H2 310 332 2.17e-1 SMART
ZnF_C2H2 338 360 1.04e-3 SMART
ZnF_C2H2 366 388 2.24e-3 SMART
ZnF_C2H2 394 416 2.24e-3 SMART
ZnF_C2H2 421 443 4.61e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131237
SMART Domains Protein: ENSMUSP00000122942
Gene: ENSMUSG00000052446

DomainStartEndE-ValueType
KRAB 6 63 1.14e-18 SMART
ZnF_C2H2 125 147 1.69e-3 SMART
ZnF_C2H2 153 175 3.07e-1 SMART
ZnF_C2H2 180 202 1.36e-2 SMART
ZnF_C2H2 207 229 3.29e-1 SMART
ZnF_C2H2 235 257 3.34e-2 SMART
ZnF_C2H2 263 285 9.58e-3 SMART
ZnF_C2H2 291 313 2.17e-1 SMART
ZnF_C2H2 319 341 1.04e-3 SMART
ZnF_C2H2 347 369 2.24e-3 SMART
ZnF_C2H2 375 397 2.24e-3 SMART
ZnF_C2H2 402 424 4.61e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132848
AA Change: V4A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000114730
Gene: ENSMUSG00000052446
AA Change: V4A

DomainStartEndE-ValueType
KRAB 25 82 1.14e-18 SMART
ZnF_C2H2 144 166 1.69e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122589
Gene: ENSMUSG00000052446
AA Change: V4A

DomainStartEndE-ValueType
KRAB 25 82 1.14e-18 SMART
ZnF_C2H2 144 166 1.69e-3 SMART
ZnF_C2H2 172 194 3.07e-1 SMART
ZnF_C2H2 199 221 1.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138304
AA Change: V4A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000145256
AA Change: V4A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl T C 1: 66,838,324 E356G probably benign Het
Adamtsl3 T C 7: 82,450,163 L175P probably damaging Het
Apon T C 10: 128,254,459 I2T probably benign Het
Ccny T A 18: 9,386,782 D61V probably damaging Het
Cp A G 3: 19,971,055 T393A probably benign Het
Cspg5 T C 9: 110,251,066 L434P probably damaging Het
Cyld T A 8: 88,709,988 I302N probably damaging Het
Ercc4 T C 16: 13,125,305 S283P probably damaging Het
Frem3 T A 8: 80,611,721 Y214* probably null Het
Gm1123 T C 9: 99,014,054 N258D possibly damaging Het
Gm9821 A T 2: 91,946,006 H101L unknown Het
Il1f8 T A 2: 24,154,614 C9S probably benign Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Mansc1 T C 6: 134,610,414 T267A probably benign Het
Mtor A G 4: 148,454,646 D200G probably damaging Het
Muc5ac G C 7: 141,803,429 V1148L possibly damaging Het
Mycbp2 C A 14: 103,156,305 R2940L probably damaging Het
Myh7 A G 14: 54,990,043 F312L probably benign Het
Olfr1183 G A 2: 88,461,712 C143Y probably damaging Het
Prkdc T A 16: 15,689,277 S874T probably benign Het
Prmt7 T G 8: 106,244,688 I452S possibly damaging Het
Setx A C 2: 29,161,550 D2038A probably damaging Het
Spen A T 4: 141,488,131 probably null Het
Sycp1 T C 3: 102,898,957 K473E probably benign Het
Uggt1 A G 1: 36,156,258 F1290S probably damaging Het
Unc13b T G 4: 43,176,285 V2371G unknown Het
Vmn2r4 C T 3: 64,409,805 V171I probably benign Het
Zfp35 T C 18: 24,003,840 C414R probably damaging Het
Zfp704 A G 3: 9,444,157 probably null Het
Zfp758 A G 17: 22,375,378 T282A probably benign Het
Other mutations in Zfp961
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Zfp961 APN 8 71968428 missense probably damaging 1.00
IGL00801:Zfp961 APN 8 71965888 missense probably damaging 1.00
IGL00825:Zfp961 APN 8 71968044 missense possibly damaging 0.91
IGL01405:Zfp961 APN 8 71967934 missense possibly damaging 0.53
IGL03100:Zfp961 APN 8 71967910 makesense probably null
R0969:Zfp961 UTSW 8 71968295 missense probably damaging 1.00
R4851:Zfp961 UTSW 8 71969003 unclassified probably benign
R5502:Zfp961 UTSW 8 71968059 missense probably damaging 0.99
R5813:Zfp961 UTSW 8 71968226 missense probably damaging 1.00
R6762:Zfp961 UTSW 8 71966114 missense possibly damaging 0.53
R6902:Zfp961 UTSW 8 71968678 missense probably damaging 1.00
X0027:Zfp961 UTSW 8 71967949 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTCCGGACTATGTTGAAGGCG -3'
(R):5'- GCAAATTAACTCCGTGGGGAC -3'

Sequencing Primer
(F):5'- ACTATGTTGAAGGCGATAGGTC -3'
(R):5'- CTGCGGGCTCTGGAAAAG -3'
Posted On2019-12-20