Incidental Mutation 'R7862:Abcc10'
ID607616
Institutional Source Beutler Lab
Gene Symbol Abcc10
Ensembl Gene ENSMUSG00000032842
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 10
SynonymsMrp7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7862 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46303221-46328352 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 46315532 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 661 (S661*)
Ref Sequence ENSEMBL: ENSMUSP00000038041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047970] [ENSMUST00000095261] [ENSMUST00000167360] [ENSMUST00000168490] [ENSMUST00000171584]
Predicted Effect probably null
Transcript: ENSMUST00000047970
AA Change: S661*
SMART Domains Protein: ENSMUSP00000038041
Gene: ENSMUSG00000032842
AA Change: S661*

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 5.4e-24 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
Pfam:ABC_membrane 889 1203 1.7e-33 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1490 3.57e-13 SMART
low complexity region 1506 1517 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095261
AA Change: S620*
SMART Domains Protein: ENSMUSP00000092895
Gene: ENSMUSG00000032842
AA Change: S620*

DomainStartEndE-ValueType
transmembrane domain 29 48 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 93 112 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
Pfam:ABC_membrane 245 511 2.1e-30 PFAM
AAA 585 768 5.76e-8 SMART
low complexity region 800 811 N/A INTRINSIC
transmembrane domain 836 858 N/A INTRINSIC
Pfam:ABC_membrane 896 1162 6.9e-26 PFAM
low complexity region 1190 1204 N/A INTRINSIC
AAA 1240 1424 1.67e-13 SMART
low complexity region 1440 1451 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167360
AA Change: S661*
SMART Domains Protein: ENSMUSP00000131843
Gene: ENSMUSG00000032842
AA Change: S661*

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 2.2e-30 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
transmembrane domain 877 899 N/A INTRINSIC
Pfam:ABC_membrane 937 1203 7.2e-26 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1465 1.67e-13 SMART
low complexity region 1481 1492 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168490
AA Change: S110*
SMART Domains Protein: ENSMUSP00000132760
Gene: ENSMUSG00000032842
AA Change: S110*

DomainStartEndE-ValueType
AAA 75 242 4.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171584
SMART Domains Protein: ENSMUSP00000132561
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 462 8.3e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This ABC transporter is a member of the MRP subfamily which is involved in multi-drug resistance. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homzozygous for a knock-out allele exhibit increased sensitivity to paclitaxel-induced mortality associated with weight loss, decreased white blood cell, and small spleen and thymus cortex due to apoptosis and/or depopulation of lymphoid cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A C 3: 145,943,869 *181S probably null Het
Abtb2 C T 2: 103,702,281 R475W probably damaging Het
Cep97 T C 16: 55,905,721 D673G probably benign Het
Chaf1b T C 16: 93,888,095 M144T possibly damaging Het
Chd8 T C 14: 52,214,277 D1372G probably damaging Het
Chmp6 G A 11: 119,917,010 probably null Het
Cst12 T C 2: 148,789,575 V72A probably damaging Het
D1Pas1 G A 1: 186,968,152 G93R probably damaging Het
Dhx34 C A 7: 16,210,523 V589F probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmrta1 C A 4: 89,688,324 H6N probably benign Het
Dopey2 T C 16: 93,749,963 L285P probably damaging Het
Dpy19l1 T C 9: 24,475,434 Y188C probably damaging Het
Ehbp1l1 C T 19: 5,720,823 R230Q probably benign Het
Ep300 T G 15: 81,650,753 V2337G probably damaging Het
Fh1 A T 1: 175,614,834 V150E probably damaging Het
Fkbp11 G A 15: 98,726,508 R122* probably null Het
Fkbp5 C T 17: 28,412,039 E251K probably damaging Het
Fmnl1 A G 11: 103,180,930 K88E probably damaging Het
Frrs1 T C 3: 116,891,880 V300A possibly damaging Het
Glud1 T G 14: 34,325,522 L198V possibly damaging Het
Gsdmc A T 15: 63,777,996 W349R possibly damaging Het
Hacd1 T C 2: 14,045,202 H64R probably damaging Het
Haus2 T A 2: 120,613,089 D75E probably benign Het
Hmcn1 A T 1: 150,806,421 F459L probably damaging Het
Ighe A T 12: 113,271,808 V272E Het
Iqgap1 C T 7: 80,743,888 R647H probably benign Het
Jmy T C 13: 93,499,195 I38V possibly damaging Het
Kcnh1 G T 1: 192,190,859 probably benign Het
Kctd20 C T 17: 28,962,875 A167V probably damaging Het
Klhl38 A T 15: 58,314,999 V525E probably damaging Het
Krit1 A G 5: 3,812,788 D259G probably damaging Het
Med1 A T 11: 98,161,210 C443S probably benign Het
Mllt6 T C 11: 97,665,805 V107A probably benign Het
Myl7 A G 11: 5,897,157 M132T probably benign Het
Myo10 T C 15: 25,666,436 V11A probably damaging Het
Nipbl T C 15: 8,325,752 I1642V probably benign Het
Olfr1256 T C 2: 89,835,124 T274A probably benign Het
Olfr807 T C 10: 129,755,355 T32A probably benign Het
Olfr843 C A 9: 19,249,440 probably benign Het
Olfr918 C T 9: 38,673,328 V39M probably benign Het
Pcdhb2 C T 18: 37,296,060 A362V probably benign Het
Pnp2 A T 14: 50,963,559 D167V possibly damaging Het
Rasa1 G A 13: 85,255,411 T282I probably damaging Het
Rp1l1 A G 14: 64,028,027 D354G probably damaging Het
Rpap1 C T 2: 119,775,412 probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Shank3 A G 15: 89,505,445 D415G possibly damaging Het
Slc12a1 A G 2: 125,161,094 I182V probably damaging Het
Slc6a13 A G 6: 121,335,630 Y441C probably damaging Het
Sltm G T 9: 70,572,164 E193* probably null Het
Spag9 T C 11: 94,112,066 I1134T possibly damaging Het
Spta1 G A 1: 174,197,785 probably null Het
Stk3 A G 15: 35,115,586 V29A possibly damaging Het
Tgfbr1 A T 4: 47,403,489 I365F probably damaging Het
Thpo C T 16: 20,728,790 V24I probably benign Het
Tle1 A C 4: 72,199,315 L36R probably damaging Het
Togaram2 T C 17: 71,689,173 V57A probably benign Het
Ttll9 C T 2: 153,006,975 A459V probably benign Het
Ush1c T C 7: 46,221,424 I330V probably damaging Het
Usp34 T C 11: 23,464,718 M2906T Het
Vmn2r28 A T 7: 5,490,614 M111K probably benign Het
Vmn2r97 T C 17: 18,947,154 C557R probably damaging Het
Zfp873 T A 10: 82,060,275 I280K probably benign Het
Other mutations in Abcc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Abcc10 APN 17 46323745 missense probably damaging 1.00
IGL01115:Abcc10 APN 17 46310426 missense probably benign
IGL01380:Abcc10 APN 17 46324022 missense possibly damaging 0.90
IGL01476:Abcc10 APN 17 46327937 utr 5 prime probably benign
IGL01723:Abcc10 APN 17 46313745 missense probably damaging 1.00
IGL01867:Abcc10 APN 17 46324438 missense probably benign 0.07
IGL02065:Abcc10 APN 17 46312901 missense possibly damaging 0.60
IGL02233:Abcc10 APN 17 46324159 splice site probably null
IGL03394:Abcc10 APN 17 46324351 missense probably damaging 1.00
Decrepit UTSW 17 46324391 missense probably damaging 1.00
Shrivelled UTSW 17 46312419 missense probably benign
PIT4514001:Abcc10 UTSW 17 46305648 missense probably benign
R0366:Abcc10 UTSW 17 46324798 nonsense probably null
R0437:Abcc10 UTSW 17 46312919 splice site probably null
R0437:Abcc10 UTSW 17 46312920 splice site probably benign
R0549:Abcc10 UTSW 17 46322290 missense probably damaging 1.00
R0580:Abcc10 UTSW 17 46305956 splice site probably null
R1056:Abcc10 UTSW 17 46303954 missense possibly damaging 0.60
R1426:Abcc10 UTSW 17 46324435 missense probably damaging 0.97
R1595:Abcc10 UTSW 17 46322238 missense probably damaging 1.00
R1745:Abcc10 UTSW 17 46312433 missense probably benign
R1856:Abcc10 UTSW 17 46306603 missense probably damaging 1.00
R1968:Abcc10 UTSW 17 46322199 missense probably damaging 1.00
R2070:Abcc10 UTSW 17 46303565 missense probably benign
R2071:Abcc10 UTSW 17 46303565 missense probably benign
R2255:Abcc10 UTSW 17 46305635 missense probably benign 0.18
R2425:Abcc10 UTSW 17 46310157 missense probably damaging 1.00
R4116:Abcc10 UTSW 17 46323891 missense possibly damaging 0.50
R4510:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4511:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4645:Abcc10 UTSW 17 46324774 missense probably damaging 1.00
R4689:Abcc10 UTSW 17 46324070 missense probably benign 0.00
R4778:Abcc10 UTSW 17 46304416 missense probably damaging 1.00
R5364:Abcc10 UTSW 17 46305651 missense probably benign 0.25
R5384:Abcc10 UTSW 17 46304435 missense possibly damaging 0.83
R5509:Abcc10 UTSW 17 46324259 missense probably benign 0.01
R5568:Abcc10 UTSW 17 46303908 splice site probably null
R5798:Abcc10 UTSW 17 46306003 nonsense probably null
R5906:Abcc10 UTSW 17 46316559 missense probably benign 0.02
R5908:Abcc10 UTSW 17 46313804 missense probably damaging 1.00
R5942:Abcc10 UTSW 17 46312407 missense probably benign 0.02
R5968:Abcc10 UTSW 17 46310151 missense probably benign
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6109:Abcc10 UTSW 17 46310377 missense probably benign 0.00
R6623:Abcc10 UTSW 17 46323462 missense probably damaging 1.00
R6851:Abcc10 UTSW 17 46312419 missense probably benign
R6927:Abcc10 UTSW 17 46324391 missense probably damaging 1.00
R7176:Abcc10 UTSW 17 46324277 missense probably benign 0.02
R7314:Abcc10 UTSW 17 46315404 missense probably damaging 0.98
R7463:Abcc10 UTSW 17 46323772 missense probably damaging 1.00
R7527:Abcc10 UTSW 17 46312904 missense possibly damaging 0.58
R7584:Abcc10 UTSW 17 46315378 splice site probably null
R7883:Abcc10 UTSW 17 46307101 missense probably benign 0.03
R7896:Abcc10 UTSW 17 46324309 missense probably benign 0.08
R7897:Abcc10 UTSW 17 46324073 missense probably benign 0.00
R8316:Abcc10 UTSW 17 46327809 missense probably damaging 0.99
R8354:Abcc10 UTSW 17 46324177 missense possibly damaging 0.75
R8414:Abcc10 UTSW 17 46312347 missense probably benign 0.28
R8454:Abcc10 UTSW 17 46324177 missense possibly damaging 0.75
X0020:Abcc10 UTSW 17 46324120 missense probably damaging 0.98
Z1176:Abcc10 UTSW 17 46313700 missense probably damaging 0.97
Z1176:Abcc10 UTSW 17 46324262 missense probably benign 0.00
Z1177:Abcc10 UTSW 17 46307062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTCAAGCTAGGTACTCACAC -3'
(R):5'- GATGAGCCTTGCCTGAGTTC -3'

Sequencing Primer
(F):5'- CACTTAGATCATCATTGAGGGCGC -3'
(R):5'- CCACAGTGTGTCTATGGGAC -3'
Posted On2019-12-20