Incidental Mutation 'R7862:Spta1'
ID607556
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Namespectrin alpha, erythrocytic 1
Synonymserythroid, Spna-1, ihj, Spna1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.682) question?
Stock #R7862 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location174172776-174248450 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 174197785 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817]
Predicted Effect probably null
Transcript: ENSMUST00000027817
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A C 3: 145,943,869 *181S probably null Het
Abcc10 G T 17: 46,315,532 S661* probably null Het
Abtb2 C T 2: 103,702,281 R475W probably damaging Het
Cep97 T C 16: 55,905,721 D673G probably benign Het
Chaf1b T C 16: 93,888,095 M144T possibly damaging Het
Chd8 T C 14: 52,214,277 D1372G probably damaging Het
Chmp6 G A 11: 119,917,010 probably null Het
Cst12 T C 2: 148,789,575 V72A probably damaging Het
D1Pas1 G A 1: 186,968,152 G93R probably damaging Het
Dhx34 C A 7: 16,210,523 V589F probably damaging Het
Dlg5 G A 14: 24,245,212 P80L probably damaging Het
Dmrta1 C A 4: 89,688,324 H6N probably benign Het
Dopey2 T C 16: 93,749,963 L285P probably damaging Het
Dpy19l1 T C 9: 24,475,434 Y188C probably damaging Het
Ehbp1l1 C T 19: 5,720,823 R230Q probably benign Het
Ep300 T G 15: 81,650,753 V2337G probably damaging Het
Fh1 A T 1: 175,614,834 V150E probably damaging Het
Fkbp11 G A 15: 98,726,508 R122* probably null Het
Fkbp5 C T 17: 28,412,039 E251K probably damaging Het
Fmnl1 A G 11: 103,180,930 K88E probably damaging Het
Frrs1 T C 3: 116,891,880 V300A possibly damaging Het
Glud1 T G 14: 34,325,522 L198V possibly damaging Het
Gsdmc A T 15: 63,777,996 W349R possibly damaging Het
Hacd1 T C 2: 14,045,202 H64R probably damaging Het
Haus2 T A 2: 120,613,089 D75E probably benign Het
Hmcn1 A T 1: 150,806,421 F459L probably damaging Het
Ighe A T 12: 113,271,808 V272E Het
Iqgap1 C T 7: 80,743,888 R647H probably benign Het
Jmy T C 13: 93,499,195 I38V possibly damaging Het
Kcnh1 G T 1: 192,190,859 probably benign Het
Kctd20 C T 17: 28,962,875 A167V probably damaging Het
Klhl38 A T 15: 58,314,999 V525E probably damaging Het
Krit1 A G 5: 3,812,788 D259G probably damaging Het
Med1 A T 11: 98,161,210 C443S probably benign Het
Mllt6 T C 11: 97,665,805 V107A probably benign Het
Myl7 A G 11: 5,897,157 M132T probably benign Het
Myo10 T C 15: 25,666,436 V11A probably damaging Het
Nipbl T C 15: 8,325,752 I1642V probably benign Het
Olfr1256 T C 2: 89,835,124 T274A probably benign Het
Olfr807 T C 10: 129,755,355 T32A probably benign Het
Olfr843 C A 9: 19,249,440 probably benign Het
Olfr918 C T 9: 38,673,328 V39M probably benign Het
Pcdhb2 C T 18: 37,296,060 A362V probably benign Het
Pnp2 A T 14: 50,963,559 D167V possibly damaging Het
Rasa1 G A 13: 85,255,411 T282I probably damaging Het
Rp1l1 A G 14: 64,028,027 D354G probably damaging Het
Rpap1 C T 2: 119,775,412 probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Shank3 A G 15: 89,505,445 D415G possibly damaging Het
Slc12a1 A G 2: 125,161,094 I182V probably damaging Het
Slc6a13 A G 6: 121,335,630 Y441C probably damaging Het
Sltm G T 9: 70,572,164 E193* probably null Het
Spag9 T C 11: 94,112,066 I1134T possibly damaging Het
Stk3 A G 15: 35,115,586 V29A possibly damaging Het
Tgfbr1 A T 4: 47,403,489 I365F probably damaging Het
Thpo C T 16: 20,728,790 V24I probably benign Het
Tle1 A C 4: 72,199,315 L36R probably damaging Het
Togaram2 T C 17: 71,689,173 V57A probably benign Het
Ttll9 C T 2: 153,006,975 A459V probably benign Het
Ush1c T C 7: 46,221,424 I330V probably damaging Het
Usp34 T C 11: 23,464,718 M2906T Het
Vmn2r28 A T 7: 5,490,614 M111K probably benign Het
Vmn2r97 T C 17: 18,947,154 C557R probably damaging Het
Zfp873 T A 10: 82,060,275 I280K probably benign Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174208390 nonsense probably null
IGL01095:Spta1 APN 1 174213485 missense probably benign 0.02
IGL01144:Spta1 APN 1 174187263 missense probably benign 0.05
IGL01455:Spta1 APN 1 174203311 missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174217159 missense probably benign 0.03
IGL01613:Spta1 APN 1 174208394 missense probably damaging 1.00
IGL01804:Spta1 APN 1 174244180 missense probably benign 0.42
IGL01859:Spta1 APN 1 174174372 missense probably damaging 1.00
IGL01898:Spta1 APN 1 174213862 missense probably benign 0.00
IGL02106:Spta1 APN 1 174203294 missense probably benign 0.02
IGL02166:Spta1 APN 1 174190231 missense probably damaging 1.00
IGL02224:Spta1 APN 1 174217689 critical splice donor site probably benign
IGL02318:Spta1 APN 1 174174463 missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174218814 missense probably damaging 0.96
IGL02852:Spta1 APN 1 174244110 missense probably benign 0.24
IGL02861:Spta1 APN 1 174211598 missense probably damaging 1.00
IGL02982:Spta1 APN 1 174187288 missense probably benign 0.00
IGL03057:Spta1 APN 1 174181058 missense probably benign 0.19
IGL03215:Spta1 APN 1 174218743 missense probably damaging 1.00
IGL03263:Spta1 APN 1 174213918 missense probably damaging 0.99
IGL03272:Spta1 APN 1 174214144 missense probably benign 0.08
H8786:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0078:Spta1 UTSW 1 174207032 splice site probably benign
R0172:Spta1 UTSW 1 174230786 missense probably damaging 1.00
R0206:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0208:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0276:Spta1 UTSW 1 174217894 missense probably damaging 1.00
R0288:Spta1 UTSW 1 174243179 missense probably damaging 0.99
R0323:Spta1 UTSW 1 174218451 missense probably damaging 1.00
R0454:Spta1 UTSW 1 174213942 missense probably damaging 1.00
R0508:Spta1 UTSW 1 174224457 missense probably damaging 1.00
R0698:Spta1 UTSW 1 174181104 missense probably damaging 1.00
R0751:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R0925:Spta1 UTSW 1 174174426 missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174245205 unclassified probably benign
R1131:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R1171:Spta1 UTSW 1 174211614 nonsense probably null
R1184:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R1401:Spta1 UTSW 1 174222684 missense probably damaging 1.00
R1489:Spta1 UTSW 1 174231325 missense probably damaging 0.97
R1532:Spta1 UTSW 1 174247353 missense probably damaging 0.99
R1551:Spta1 UTSW 1 174240166 missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174178749 missense probably damaging 0.99
R1566:Spta1 UTSW 1 174184706 missense probably benign 0.00
R1586:Spta1 UTSW 1 174213495 missense probably benign 0.00
R1676:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R1711:Spta1 UTSW 1 174241042 missense probably damaging 1.00
R1795:Spta1 UTSW 1 174245730 missense probably damaging 1.00
R1823:Spta1 UTSW 1 174246549 missense probably benign 0.05
R1842:Spta1 UTSW 1 174195947 missense probably benign 0.00
R1867:Spta1 UTSW 1 174219839 missense probably benign 0.33
R1970:Spta1 UTSW 1 174240367 missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174211647 missense probably benign 0.20
R2095:Spta1 UTSW 1 174244198 missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174208344 missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174212614 missense probably benign 0.00
R2158:Spta1 UTSW 1 174229258 missense probably benign 0.41
R2187:Spta1 UTSW 1 174192966 missense probably damaging 1.00
R2250:Spta1 UTSW 1 174244114 missense probably damaging 1.00
R2258:Spta1 UTSW 1 174174341 missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174178656 critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R4058:Spta1 UTSW 1 174241137 missense probably damaging 1.00
R4080:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4081:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4082:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4108:Spta1 UTSW 1 174174556 missense probably benign 0.01
R4115:Spta1 UTSW 1 174240357 missense probably damaging 1.00
R4303:Spta1 UTSW 1 174179852 missense probably damaging 1.00
R4419:Spta1 UTSW 1 174247424 nonsense probably null
R4525:Spta1 UTSW 1 174207110 missense probably null 1.00
R4614:Spta1 UTSW 1 174192977 missense probably damaging 1.00
R4673:Spta1 UTSW 1 174191062 splice site probably null
R4782:Spta1 UTSW 1 174230666 missense probably benign 0.01
R4825:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174237927 missense probably benign 0.01
R4873:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4875:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4898:Spta1 UTSW 1 174237834 missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174217863 splice site probably null
R4911:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R4928:Spta1 UTSW 1 174191056 missense probably benign 0.15
R4959:Spta1 UTSW 1 174246608 missense probably damaging 0.97
R5009:Spta1 UTSW 1 174240223 missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174247434 missense probably damaging 0.99
R5293:Spta1 UTSW 1 174195985 missense probably damaging 0.99
R5421:Spta1 UTSW 1 174215529 missense probably damaging 0.99
R5457:Spta1 UTSW 1 174217193 missense probably damaging 1.00
R5590:Spta1 UTSW 1 174175770 missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174219902 missense probably damaging 1.00
R5736:Spta1 UTSW 1 174214255 critical splice donor site probably null
R5834:Spta1 UTSW 1 174184797 intron probably null
R5845:Spta1 UTSW 1 174241096 missense probably damaging 0.97
R5987:Spta1 UTSW 1 174223328 missense probably damaging 1.00
R6102:Spta1 UTSW 1 174224520 missense probably benign 0.01
R6221:Spta1 UTSW 1 174181776 missense probably damaging 1.00
R6276:Spta1 UTSW 1 174218512 missense probably damaging 1.00
R6317:Spta1 UTSW 1 174241087 missense probably damaging 1.00
R6329:Spta1 UTSW 1 174214177 missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174211646 missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174214168 missense probably damaging 1.00
R6376:Spta1 UTSW 1 174203322 missense probably benign
R6387:Spta1 UTSW 1 174231333 missense probably benign 0.01
R6451:Spta1 UTSW 1 174217201 missense probably damaging 0.97
R6480:Spta1 UTSW 1 174187148 intron probably null
R6533:Spta1 UTSW 1 174244147 missense probably damaging 1.00
R6585:Spta1 UTSW 1 174178685 missense probably damaging 1.00
R6695:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174209325 missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174209352 missense probably damaging 1.00
R7086:Spta1 UTSW 1 174199484 missense probably damaging 0.98
R7087:Spta1 UTSW 1 174174510 missense probably benign
R7151:Spta1 UTSW 1 174197751 missense probably damaging 1.00
R7193:Spta1 UTSW 1 174184612 missense probably damaging 1.00
R7199:Spta1 UTSW 1 174223271 missense possibly damaging 0.61
R7219:Spta1 UTSW 1 174222637 missense probably damaging 0.96
R7343:Spta1 UTSW 1 174223349 missense probably damaging 0.99
R7372:Spta1 UTSW 1 174197635 nonsense probably null
R7472:Spta1 UTSW 1 174246499 missense probably damaging 1.00
R7516:Spta1 UTSW 1 174197783 missense probably damaging 1.00
R7627:Spta1 UTSW 1 174205378 missense probably damaging 1.00
R7770:Spta1 UTSW 1 174195981 nonsense probably null
R7784:Spta1 UTSW 1 174202451 missense probably damaging 1.00
R7804:Spta1 UTSW 1 174195905 missense possibly damaging 0.50
R7854:Spta1 UTSW 1 174218830 critical splice donor site probably null
R7937:Spta1 UTSW 1 174218830 critical splice donor site probably null
R7945:Spta1 UTSW 1 174197785 critical splice donor site probably null
R8015:Spta1 UTSW 1 174240171 missense probably damaging 1.00
RF002:Spta1 UTSW 1 174231360 missense possibly damaging 0.62
RF018:Spta1 UTSW 1 174209319 missense probably damaging 1.00
RF020:Spta1 UTSW 1 174213444 missense probably benign 0.42
RF020:Spta1 UTSW 1 174217903 missense probably damaging 1.00
T0722:Spta1 UTSW 1 174191066 splice site probably benign
X0028:Spta1 UTSW 1 174224450 missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174191051 missense probably damaging 1.00
Z1176:Spta1 UTSW 1 174240367 missense probably damaging 0.99
Z1177:Spta1 UTSW 1 174190162 missense probably benign 0.09
Z1177:Spta1 UTSW 1 174245689 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCAGGGACTCAGCTGTATG -3'
(R):5'- CTCAGAGAATGGCATGATACTCAG -3'

Sequencing Primer
(F):5'- ACCAGCTGCTACAGTTTG -3'
(R):5'- CTCAGAAGAGTCAACTAGTTTTTCC -3'
Posted On2019-12-20