Incidental Mutation 'R7584:Abcc10'
ID628260
Institutional Source Beutler Lab
Gene Symbol Abcc10
Ensembl Gene ENSMUSG00000032842
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 10
SynonymsMrp7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R7584 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46303221-46328352 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 46315378 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047970] [ENSMUST00000095261] [ENSMUST00000167360] [ENSMUST00000168490] [ENSMUST00000171584]
Predicted Effect probably null
Transcript: ENSMUST00000047970
SMART Domains Protein: ENSMUSP00000038041
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 5.4e-24 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
Pfam:ABC_membrane 889 1203 1.7e-33 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1490 3.57e-13 SMART
low complexity region 1506 1517 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095261
SMART Domains Protein: ENSMUSP00000092895
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 29 48 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 93 112 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
Pfam:ABC_membrane 245 511 2.1e-30 PFAM
AAA 585 768 5.76e-8 SMART
low complexity region 800 811 N/A INTRINSIC
transmembrane domain 836 858 N/A INTRINSIC
Pfam:ABC_membrane 896 1162 6.9e-26 PFAM
low complexity region 1190 1204 N/A INTRINSIC
AAA 1240 1424 1.67e-13 SMART
low complexity region 1440 1451 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167360
SMART Domains Protein: ENSMUSP00000131843
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 2.2e-30 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
transmembrane domain 877 899 N/A INTRINSIC
Pfam:ABC_membrane 937 1203 7.2e-26 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1465 1.67e-13 SMART
low complexity region 1481 1492 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168490
SMART Domains Protein: ENSMUSP00000132760
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
AAA 75 242 4.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171584
SMART Domains Protein: ENSMUSP00000132561
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 462 8.3e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This ABC transporter is a member of the MRP subfamily which is involved in multi-drug resistance. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homzozygous for a knock-out allele exhibit increased sensitivity to paclitaxel-induced mortality associated with weight loss, decreased white blood cell, and small spleen and thymus cortex due to apoptosis and/or depopulation of lymphoid cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,110,361 F69L possibly damaging Het
1700123L14Rik A C 6: 96,165,392 L224V probably benign Het
Actrt3 T C 3: 30,598,207 K246R probably benign Het
Adam23 T A 1: 63,545,462 V343D probably damaging Het
Ak2 T C 4: 128,999,212 S55P probably damaging Het
Ank2 G A 3: 126,946,128 Q2036* probably null Het
Ano10 A G 9: 122,275,531 I40T probably benign Het
Aoc2 T A 11: 101,326,179 C363S possibly damaging Het
Aplp2 A T 9: 31,157,781 V584E possibly damaging Het
Arhgap32 A T 9: 32,256,967 T749S probably benign Het
Atm A T 9: 53,513,127 F625I probably damaging Het
Atr T C 9: 95,942,713 L2387P probably damaging Het
Barhl1 C T 2: 28,909,791 G274D probably damaging Het
Bcl2a1a A T 9: 88,957,292 D81V probably damaging Het
Ccdc63 T G 5: 122,113,204 D381A possibly damaging Het
Col12a1 A G 9: 79,703,296 probably null Het
Crat C T 2: 30,404,565 R497Q probably benign Het
Cyp4b1 T A 4: 115,628,687 D351V probably damaging Het
D130043K22Rik A G 13: 24,872,370 S562G probably damaging Het
D430042O09Rik G T 7: 125,870,666 V1436L probably damaging Het
Dgkb T A 12: 38,139,392 probably null Het
Dmbt1 C T 7: 131,088,751 Q905* probably null Het
Dnajc21 A C 15: 10,462,295 Y81* probably null Het
Dnali1 T C 4: 125,065,538 T21A probably benign Het
Dpp8 A T 9: 65,078,782 L851F probably damaging Het
Dpt T C 1: 164,818,908 Y149H probably benign Het
Ep300 T C 15: 81,628,426 V983A unknown Het
Faf1 C T 4: 109,925,957 R549C probably damaging Het
Gcm1 A G 9: 78,064,467 N230S possibly damaging Het
Gm10803 T A 2: 93,564,168 I95N probably damaging Het
Hectd4 T A 5: 121,318,735 I721N possibly damaging Het
Hsp90ab1 T C 17: 45,570,271 H315R probably damaging Het
Igkv10-95 T A 6: 68,680,756 S85R possibly damaging Het
Kcnq5 T C 1: 21,402,321 T901A probably benign Het
Kremen1 C T 11: 5,194,964 V471M possibly damaging Het
Lama2 C A 10: 27,104,261 D1853Y possibly damaging Het
Lrif1 A G 3: 106,731,901 T76A probably benign Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Ltbr G T 6: 125,307,241 Q413K probably benign Het
Myrfl T A 10: 116,828,997 Y376F probably damaging Het
Nup98 G T 7: 102,176,389 N414K probably benign Het
Nynrin A G 14: 55,871,584 T1383A probably damaging Het
Olfr1106 A T 2: 87,049,134 I34N probably benign Het
Olfr1211 G A 2: 88,929,805 P170L probably damaging Het
Olfr784 T A 10: 129,388,032 I133N probably damaging Het
Olfr845 C A 9: 19,339,273 T271K possibly damaging Het
Olfr915 G T 9: 38,646,895 P210T possibly damaging Het
Pcdhb5 T A 18: 37,322,372 S602T possibly damaging Het
Sall3 A G 18: 80,974,530 F61S probably benign Het
Scube1 G T 15: 83,721,887 C61* probably null Het
Sec31b T C 19: 44,531,556 probably null Het
Sec31b T C 19: 44,543,323 D49G probably damaging Het
Skiv2l A G 17: 34,841,675 I822T possibly damaging Het
Slc19a3 C T 1: 83,022,748 V183M possibly damaging Het
Slc41a2 T C 10: 83,316,789 probably benign Het
Sphk2 C A 7: 45,712,507 V169L probably damaging Het
Synpo C A 18: 60,596,277 R951L probably damaging Het
Tbc1d9b G A 11: 50,170,716 C1017Y probably damaging Het
Tmtc4 C A 14: 122,978,151 V28F probably benign Het
Tprkb A G 6: 85,928,827 I165V probably benign Het
Ttc23l T A 15: 10,533,708 I250F probably damaging Het
Ubr3 G A 2: 69,991,503 V1370I probably damaging Het
Ush2a A G 1: 188,728,109 probably null Het
Usp9y T C Y: 1,384,451 Y689C probably damaging Het
Vmn1r56 A T 7: 5,195,896 Y241N probably damaging Het
Vmn2r6 T C 3: 64,565,262 T13A probably benign Het
Vmn2r92 T A 17: 18,166,766 N122K probably benign Het
Vps9d1 A G 8: 123,250,717 F131S probably damaging Het
Vwa8 A C 14: 78,982,234 probably null Het
Wfdc16 A T 2: 164,638,627 probably null Het
Zbtb41 T A 1: 139,424,057 Y303N probably benign Het
Zbtb5 T C 4: 44,993,678 T569A probably benign Het
Zcchc11 T C 4: 108,479,346 V89A probably benign Het
Zfp111 A G 7: 24,198,600 S530P possibly damaging Het
Other mutations in Abcc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Abcc10 APN 17 46323745 missense probably damaging 1.00
IGL01115:Abcc10 APN 17 46310426 missense probably benign
IGL01380:Abcc10 APN 17 46324022 missense possibly damaging 0.90
IGL01476:Abcc10 APN 17 46327937 utr 5 prime probably benign
IGL01723:Abcc10 APN 17 46313745 missense probably damaging 1.00
IGL01867:Abcc10 APN 17 46324438 missense probably benign 0.07
IGL02065:Abcc10 APN 17 46312901 missense possibly damaging 0.60
IGL02233:Abcc10 APN 17 46324159 splice site probably null
IGL03394:Abcc10 APN 17 46324351 missense probably damaging 1.00
Decrepit UTSW 17 46324391 missense probably damaging 1.00
Shrivelled UTSW 17 46312419 missense probably benign
PIT4514001:Abcc10 UTSW 17 46305648 missense probably benign
R0366:Abcc10 UTSW 17 46324798 nonsense probably null
R0437:Abcc10 UTSW 17 46312919 splice site probably null
R0437:Abcc10 UTSW 17 46312920 splice site probably benign
R0549:Abcc10 UTSW 17 46322290 missense probably damaging 1.00
R0580:Abcc10 UTSW 17 46305956 splice site probably null
R1056:Abcc10 UTSW 17 46303954 missense possibly damaging 0.60
R1426:Abcc10 UTSW 17 46324435 missense probably damaging 0.97
R1595:Abcc10 UTSW 17 46322238 missense probably damaging 1.00
R1745:Abcc10 UTSW 17 46312433 missense probably benign
R1856:Abcc10 UTSW 17 46306603 missense probably damaging 1.00
R1968:Abcc10 UTSW 17 46322199 missense probably damaging 1.00
R2070:Abcc10 UTSW 17 46303565 missense probably benign
R2071:Abcc10 UTSW 17 46303565 missense probably benign
R2255:Abcc10 UTSW 17 46305635 missense probably benign 0.18
R2425:Abcc10 UTSW 17 46310157 missense probably damaging 1.00
R4116:Abcc10 UTSW 17 46323891 missense possibly damaging 0.50
R4510:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4511:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4645:Abcc10 UTSW 17 46324774 missense probably damaging 1.00
R4689:Abcc10 UTSW 17 46324070 missense probably benign 0.00
R4778:Abcc10 UTSW 17 46304416 missense probably damaging 1.00
R5364:Abcc10 UTSW 17 46305651 missense probably benign 0.25
R5384:Abcc10 UTSW 17 46304435 missense possibly damaging 0.83
R5509:Abcc10 UTSW 17 46324259 missense probably benign 0.01
R5568:Abcc10 UTSW 17 46303908 splice site probably null
R5798:Abcc10 UTSW 17 46306003 nonsense probably null
R5906:Abcc10 UTSW 17 46316559 missense probably benign 0.02
R5908:Abcc10 UTSW 17 46313804 missense probably damaging 1.00
R5942:Abcc10 UTSW 17 46312407 missense probably benign 0.02
R5968:Abcc10 UTSW 17 46310151 missense probably benign
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6109:Abcc10 UTSW 17 46310377 missense probably benign 0.00
R6623:Abcc10 UTSW 17 46323462 missense probably damaging 1.00
R6851:Abcc10 UTSW 17 46312419 missense probably benign
R6927:Abcc10 UTSW 17 46324391 missense probably damaging 1.00
R7176:Abcc10 UTSW 17 46324277 missense probably benign 0.02
R7314:Abcc10 UTSW 17 46315404 missense probably damaging 0.98
R7463:Abcc10 UTSW 17 46323772 missense probably damaging 1.00
R7527:Abcc10 UTSW 17 46312904 missense possibly damaging 0.58
R7862:Abcc10 UTSW 17 46315532 nonsense probably null
R7883:Abcc10 UTSW 17 46307101 missense probably benign 0.03
R7896:Abcc10 UTSW 17 46324309 missense probably benign 0.08
R7897:Abcc10 UTSW 17 46324073 missense probably benign 0.00
R8316:Abcc10 UTSW 17 46327809 missense probably damaging 0.99
R8354:Abcc10 UTSW 17 46324177 missense possibly damaging 0.75
R8414:Abcc10 UTSW 17 46312347 missense probably benign 0.28
R8454:Abcc10 UTSW 17 46324177 missense possibly damaging 0.75
X0020:Abcc10 UTSW 17 46324120 missense probably damaging 0.98
Z1176:Abcc10 UTSW 17 46313700 missense probably damaging 0.97
Z1176:Abcc10 UTSW 17 46324262 missense probably benign 0.00
Z1177:Abcc10 UTSW 17 46307062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCTGTGAACCTTAGAGGGAAG -3'
(R):5'- AACCAGAAGCTAGCCTCATG -3'

Sequencing Primer
(F):5'- CCTTAGAGGGAAGTGGGGAC -3'
(R):5'- GACTCTCTGCAGGCTGTG -3'
Posted On2020-02-20