Incidental Mutation 'R7886:Nlgn1'
ID609046
Institutional Source Beutler Lab
Gene Symbol Nlgn1
Ensembl Gene ENSMUSG00000063887
Gene Nameneuroligin 1
SynonymsNL1, Nlg1, 6330415N05Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_138666.3; NM_001163387.1; MGI:2179435

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7886 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location25426215-26332460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25435907 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 552 (D552G)
Ref Sequence ENSEMBL: ENSMUSP00000142200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075054] [ENSMUST00000108308] [ENSMUST00000191835] [ENSMUST00000193603]
PDB Structure Crystal structure of a synaptic adhesion complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000075054
AA Change: D552G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074565
Gene: ENSMUSG00000063887
AA Change: D552G

DomainStartEndE-ValueType
Pfam:COesterase 29 626 4.8e-199 PFAM
Pfam:Abhydrolase_3 196 302 2.2e-8 PFAM
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 720 731 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 816 827 N/A INTRINSIC
low complexity region 829 839 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108308
AA Change: D523G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103944
Gene: ENSMUSG00000063887
AA Change: D523G

DomainStartEndE-ValueType
Pfam:COesterase 29 597 2.5e-190 PFAM
Pfam:Abhydrolase_3 176 306 4.3e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191835
AA Change: D523G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142086
Gene: ENSMUSG00000063887
AA Change: D523G

DomainStartEndE-ValueType
Pfam:COesterase 29 597 2.5e-190 PFAM
Pfam:Abhydrolase_3 176 306 4.3e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193603
AA Change: D552G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142200
Gene: ENSMUSG00000063887
AA Change: D552G

DomainStartEndE-ValueType
Pfam:COesterase 29 626 1.2e-186 PFAM
Pfam:Abhydrolase_3 196 309 3.7e-8 PFAM
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 720 731 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 816 827 N/A INTRINSIC
low complexity region 829 839 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (53/53)
MGI Phenotype Strain: 3687638
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but display impaired NMDA receptor-mediated synaptic transmission onto CA1 pyramidal cells. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730049H05Rik T G 6: 92,834,456 I130S unknown Het
Ano5 A G 7: 51,570,393 H427R probably benign Het
Atad2 A T 15: 58,126,136 V182E probably damaging Het
B4galnt1 T C 10: 127,167,054 Y147H probably damaging Het
C1s2 T C 6: 124,628,330 S349G possibly damaging Het
Ccdc51 G T 9: 109,091,587 A181S probably damaging Het
Dcc G A 18: 71,954,868 Q100* probably null Het
Dchs2 A T 3: 83,305,085 I2064F probably damaging Het
Depdc1a G A 3: 159,516,069 V217I probably benign Het
Dnajc7 A T 11: 100,601,803 F31I probably benign Het
Eftud2 C T 11: 102,840,108 R825H probably damaging Het
Fam184a T C 10: 53,675,160 E237G probably damaging Het
Fdx1l A T 9: 21,073,327 probably null Het
Frem1 T C 4: 83,016,406 D106G possibly damaging Het
Gabrg3 G A 7: 56,724,481 R446W probably damaging Het
Gm42669 A G 5: 107,508,706 E362G Het
Hmcn1 A T 1: 150,657,470 I3022N possibly damaging Het
Ifna2 C A 4: 88,683,269 V171F probably damaging Het
Igsf10 T C 3: 59,328,327 N1478D probably benign Het
Kcnc1 C A 7: 46,427,621 D282E probably damaging Het
Klhdc2 G A 12: 69,304,632 probably null Het
Macrod2 G A 2: 141,724,645 G188S probably damaging Het
Mapkbp1 T C 2: 120,012,647 F186L possibly damaging Het
Mettl21a T C 1: 64,615,184 E58G probably damaging Het
Muc16 A T 9: 18,585,982 C6625S probably benign Het
Naip5 A T 13: 100,246,181 S7T probably benign Het
Nfs1 T A 2: 156,142,061 D132V unknown Het
Numa1 C T 7: 102,013,865 T2066I probably benign Het
Olfr1355 A G 10: 78,879,823 Y217C possibly damaging Het
Olfr330 C A 11: 58,529,054 V311L probably benign Het
Olfr370 T C 8: 83,541,947 S268P possibly damaging Het
Olfr730 A T 14: 50,186,564 Y219N probably damaging Het
Olfr847 A T 9: 19,375,906 probably null Het
Pde11a C T 2: 76,291,203 V345I probably benign Het
Pglyrp2 A G 17: 32,418,761 S98P possibly damaging Het
Pik3c3 C T 18: 30,319,588 Q643* probably null Het
Pold2 T C 11: 5,872,714 Y402C probably damaging Het
Pom121 T C 5: 135,381,994 T770A unknown Het
Pou4f1 A T 14: 104,466,792 V68E probably damaging Het
Ppfia1 G T 7: 144,519,283 Q265K probably benign Het
Pygl A G 12: 70,206,356 probably null Het
Rdh19 A G 10: 127,850,300 T94A probably benign Het
Scgb1b12 A G 7: 32,334,497 T61A probably damaging Het
Sirpb1c C T 3: 15,832,202 A337T probably benign Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Tbc1d23 T C 16: 57,189,383 E381G possibly damaging Het
Tnik A G 3: 28,666,139 I1304V probably damaging Het
Tpmt C A 13: 47,040,162 G54C probably damaging Het
Usp25 A T 16: 77,113,771 Q905L probably damaging Het
Vmn1r91 T A 7: 20,101,565 N136K probably benign Het
Wdr70 C T 15: 8,079,249 E138K probably benign Het
Wrb T A 16: 96,145,568 L31Q possibly damaging Het
Zbed3 A G 13: 95,336,125 D19G possibly damaging Het
Zfp369 A G 13: 65,292,054 K184R possibly damaging Het
Other mutations in Nlgn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Nlgn1 APN 3 25436490 missense probably benign 0.02
IGL00543:Nlgn1 APN 3 25433781 missense probably damaging 1.00
IGL00960:Nlgn1 APN 3 25912697 missense probably damaging 1.00
IGL01533:Nlgn1 APN 3 25436363 missense possibly damaging 0.69
IGL02146:Nlgn1 APN 3 25912682 missense probably damaging 0.96
IGL02616:Nlgn1 APN 3 25434245 missense probably damaging 0.99
IGL03342:Nlgn1 APN 3 26133262 missense probably damaging 1.00
ligation UTSW 3 25436035 nonsense probably null
G1citation:Nlgn1 UTSW 3 26133647 missense probably benign 0.00
P0018:Nlgn1 UTSW 3 25436577 missense probably damaging 1.00
R0010:Nlgn1 UTSW 3 25435842 splice site probably benign
R0010:Nlgn1 UTSW 3 25435842 splice site probably benign
R0123:Nlgn1 UTSW 3 25435925 missense probably damaging 1.00
R0134:Nlgn1 UTSW 3 25435925 missense probably damaging 1.00
R0294:Nlgn1 UTSW 3 26133476 missense probably benign 0.23
R0798:Nlgn1 UTSW 3 25434246 missense probably benign 0.05
R1051:Nlgn1 UTSW 3 25912705 missense probably damaging 0.98
R1116:Nlgn1 UTSW 3 25433874 missense probably benign 0.00
R1289:Nlgn1 UTSW 3 25434236 missense possibly damaging 0.87
R1522:Nlgn1 UTSW 3 25435909 missense probably damaging 1.00
R1550:Nlgn1 UTSW 3 25912644 missense probably damaging 1.00
R1669:Nlgn1 UTSW 3 25436134 missense probably damaging 1.00
R1853:Nlgn1 UTSW 3 26133522 missense possibly damaging 0.80
R1856:Nlgn1 UTSW 3 25440037 nonsense probably null
R1935:Nlgn1 UTSW 3 26331790 utr 5 prime probably benign
R1936:Nlgn1 UTSW 3 26331790 utr 5 prime probably benign
R1952:Nlgn1 UTSW 3 25436300 missense probably damaging 1.00
R1953:Nlgn1 UTSW 3 25436300 missense probably damaging 1.00
R2004:Nlgn1 UTSW 3 25433870 missense probably benign 0.29
R2114:Nlgn1 UTSW 3 26133265 missense probably damaging 1.00
R2116:Nlgn1 UTSW 3 26133265 missense probably damaging 1.00
R2198:Nlgn1 UTSW 3 25433761 missense probably damaging 0.99
R2994:Nlgn1 UTSW 3 25435998 missense probably damaging 1.00
R3056:Nlgn1 UTSW 3 25433696 missense possibly damaging 0.53
R4190:Nlgn1 UTSW 3 25433898 missense probably benign
R4196:Nlgn1 UTSW 3 25434392 missense probably damaging 1.00
R4613:Nlgn1 UTSW 3 25436022 missense probably benign 0.01
R4654:Nlgn1 UTSW 3 26133701 missense possibly damaging 0.51
R4757:Nlgn1 UTSW 3 25436168 missense probably damaging 1.00
R4757:Nlgn1 UTSW 3 25436343 missense possibly damaging 0.63
R4815:Nlgn1 UTSW 3 25436030 missense probably damaging 0.99
R4884:Nlgn1 UTSW 3 25912674 missense probably damaging 1.00
R4966:Nlgn1 UTSW 3 25920237 missense possibly damaging 0.65
R5119:Nlgn1 UTSW 3 25433794 missense probably damaging 0.99
R5842:Nlgn1 UTSW 3 26133743 splice site probably null
R6218:Nlgn1 UTSW 3 25436093 missense probably damaging 1.00
R6397:Nlgn1 UTSW 3 25433663 missense possibly damaging 0.53
R6500:Nlgn1 UTSW 3 25433930 missense possibly damaging 0.84
R6822:Nlgn1 UTSW 3 26133647 missense probably benign 0.00
R6846:Nlgn1 UTSW 3 25436342 missense probably damaging 0.99
R7047:Nlgn1 UTSW 3 25436035 nonsense probably null
R7147:Nlgn1 UTSW 3 26133360 missense probably benign 0.02
R7754:Nlgn1 UTSW 3 25434303 missense probably damaging 1.00
R8184:Nlgn1 UTSW 3 25436199 missense probably damaging 1.00
R8261:Nlgn1 UTSW 3 25433652 missense possibly damaging 0.53
R8304:Nlgn1 UTSW 3 26133385 missense probably damaging 1.00
R8364:Nlgn1 UTSW 3 25435976 missense probably benign 0.00
R8503:Nlgn1 UTSW 3 26133373 missense probably damaging 0.99
Z1176:Nlgn1 UTSW 3 25436604 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCAAGAATGTTCAAAGCACTGGTTC -3'
(R):5'- GCAGACCTTCACTCGAACTTTGG -3'

Sequencing Primer
(F):5'- ACTGGTTCTATCCCCAATATCAGAG -3'
(R):5'- CGAACTTTGGCTCACCTACATAC -3'
Posted On2019-12-20