Mutagenetix > Incidental Mutation

Incidental Mutation 'R7886:Pygl'

628702

Institutional Source

Beutler Lab

Gene Symbol

Pygl

Ensembl Gene

ENSMUSG00000021069

Gene Name

liver glycogen phosphorylase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.401) question?

Stock #

R7886 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70190811-70231488 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 70206356 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071250] [ENSMUST00000161083]

AlphaFold

Q9ET01

Predicted Effect

probably null
Transcript: ENSMUST00000071250

SMART Domains

Protein: ENSMUSP00000071231
Gene: ENSMUSG00000021069

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	113	829	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000161083

SMART Domains

Protein: ENSMUSP00000125585
Gene: ENSMUSG00000021069

Domain	Start	End	E-Value	Type
Pfam:Phosphorylase	21	739	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homodimeric protein that catalyses the cleavage of alpha-1,4-glucosidic bonds to release glucose-1-phosphate from liver glycogen stores. This protein switches from inactive phosphorylase B to active phosphorylase A by phosphorylation of serine residue 15. Activity of this enzyme is further regulated by multiple allosteric effectors and hormonal controls. Humans have three glycogen phosphorylase genes that encode distinct isozymes that are primarily expressed in liver, brain and muscle, respectively. The liver isozyme serves the glycemic demands of the body in general while the brain and muscle isozymes supply just those tissues. In glycogen storage disease type VI, also known as Hers disease, mutations in liver glycogen phosphorylase inhibit the conversion of glycogen to glucose and results in moderate hypoglycemia, mild ketosis, growth retardation and hepatomegaly. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Feb 2011]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730049H05Rik	T	G	6: 92,834,456	I130S	unknown	Het
Ano5	A	G	7: 51,570,393	H427R	probably benign	Het
Atad2	A	T	15: 58,126,136	V182E	probably damaging	Het
B4galnt1	T	C	10: 127,167,054	Y147H	probably damaging	Het
C1s2	T	C	6: 124,628,330	S349G	possibly damaging	Het
Ccdc51	G	T	9: 109,091,587	A181S	probably damaging	Het
Dcc	G	A	18: 71,954,868	Q100*	probably null	Het
Dchs2	A	T	3: 83,305,085	I2064F	probably damaging	Het
Depdc1a	G	A	3: 159,516,069	V217I	probably benign	Het
Dnajc7	A	T	11: 100,601,803	F31I	probably benign	Het
Eftud2	C	T	11: 102,840,108	R825H	probably damaging	Het
Fam184a	T	C	10: 53,675,160	E237G	probably damaging	Het
Fdx1l	A	T	9: 21,073,327		probably null	Het
Frem1	T	C	4: 83,016,406	D106G	possibly damaging	Het
Gabrg3	G	A	7: 56,724,481	R446W	probably damaging	Het
Gm42669	A	G	5: 107,508,706	E362G		Het
Hmcn1	A	T	1: 150,657,470	I3022N	possibly damaging	Het
Ifna2	C	A	4: 88,683,269	V171F	probably damaging	Het
Igsf10	T	C	3: 59,328,327	N1478D	probably benign	Het
Kcnc1	C	A	7: 46,427,621	D282E	probably damaging	Het
Klhdc2	G	A	12: 69,304,632		probably null	Het
Macrod2	G	A	2: 141,724,645	G188S	probably damaging	Het
Mapkbp1	T	C	2: 120,012,647	F186L	possibly damaging	Het
Mettl21a	T	C	1: 64,615,184	E58G	probably damaging	Het
Muc16	A	T	9: 18,585,982	C6625S	probably benign	Het
Naip5	A	T	13: 100,246,181	S7T	probably benign	Het
Nfs1	T	A	2: 156,142,061	D132V	unknown	Het
Nlgn1	T	C	3: 25,435,907	D552G	probably damaging	Het
Numa1	C	T	7: 102,013,865	T2066I	probably benign	Het
Olfr1355	A	G	10: 78,879,823	Y217C	possibly damaging	Het
Olfr330	C	A	11: 58,529,054	V311L	probably benign	Het
Olfr370	T	C	8: 83,541,947	S268P	possibly damaging	Het
Olfr730	A	T	14: 50,186,564	Y219N	probably damaging	Het
Olfr847	A	T	9: 19,375,906		probably null	Het
Pde11a	C	T	2: 76,291,203	V345I	probably benign	Het
Pglyrp2	A	G	17: 32,418,761	S98P	possibly damaging	Het
Pik3c3	C	T	18: 30,319,588	Q643*	probably null	Het
Pold2	T	C	11: 5,872,714	Y402C	probably damaging	Het
Pom121	T	C	5: 135,381,994	T770A	unknown	Het
Pou4f1	A	T	14: 104,466,792	V68E	probably damaging	Het
Ppfia1	G	T	7: 144,519,283	Q265K	probably benign	Het
Rdh19	A	G	10: 127,850,300	T94A	probably benign	Het
Scgb1b12	A	G	7: 32,334,497	T61A	probably damaging	Het
Sirpb1c	C	T	3: 15,832,202	A337T	probably benign	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Tbc1d23	T	C	16: 57,189,383	E381G	possibly damaging	Het
Tnik	A	G	3: 28,666,139	I1304V	probably damaging	Het
Tpmt	C	A	13: 47,040,162	G54C	probably damaging	Het
Usp25	A	T	16: 77,113,771	Q905L	probably damaging	Het
Vmn1r91	T	A	7: 20,101,565	N136K	probably benign	Het
Wdr70	C	T	15: 8,079,249	E138K	probably benign	Het
Wrb	T	A	16: 96,145,568	L31Q	possibly damaging	Het
Zbed3	A	G	13: 95,336,125	D19G	possibly damaging	Het
Zfp369	A	G	13: 65,292,054	K184R	possibly damaging	Het

Other mutations in Pygl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pygl	APN	12	70191092	missense	probably damaging	1.00
IGL00903:Pygl	APN	12	70207742	missense	probably damaging	1.00
IGL01965:Pygl	APN	12	70191114	missense	probably benign	0.00
IGL02347:Pygl	APN	12	70201892	missense	probably benign	0.14
IGL02403:Pygl	APN	12	70194258	missense	probably benign
IGL02501:Pygl	APN	12	70191134	missense	probably benign	0.05
IGL02727:Pygl	APN	12	70207668	splice site	probably null
IGL03125:Pygl	APN	12	70197482	missense	probably damaging	1.00
IGL03158:Pygl	APN	12	70195675	missense	probably damaging	1.00
IGL03202:Pygl	APN	12	70199646	missense	probably benign
IGL03368:Pygl	APN	12	70191152	missense	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0096:Pygl	UTSW	12	70191166	splice site	probably benign
R0524:Pygl	UTSW	12	70207724	missense	probably damaging	1.00
R0883:Pygl	UTSW	12	70206404	missense	probably damaging	0.97
R0894:Pygl	UTSW	12	70194374	splice site	probably benign
R0905:Pygl	UTSW	12	70211017	splice site	probably benign
R1494:Pygl	UTSW	12	70199730	missense	probably damaging	0.98
R1621:Pygl	UTSW	12	70191092	missense	probably damaging	1.00
R1647:Pygl	UTSW	12	70197010	missense	possibly damaging	0.60
R3082:Pygl	UTSW	12	70197529	missense	probably damaging	1.00
R3845:Pygl	UTSW	12	70198443	missense	probably benign	0.12
R3876:Pygl	UTSW	12	70201339	missense	probably damaging	1.00
R4358:Pygl	UTSW	12	70195690	missense	probably damaging	1.00
R4614:Pygl	UTSW	12	70210979	splice site	probably null
R4707:Pygl	UTSW	12	70207758	missense	possibly damaging	0.69
R4908:Pygl	UTSW	12	70197033	missense	probably null
R4940:Pygl	UTSW	12	70206381	missense	probably damaging	1.00
R5077:Pygl	UTSW	12	70201892	missense	probably benign	0.14
R5186:Pygl	UTSW	12	70201344	missense	probably damaging	1.00
R5726:Pygl	UTSW	12	70191142	nonsense	probably null
R5953:Pygl	UTSW	12	70219627	missense	probably damaging	1.00
R5957:Pygl	UTSW	12	70199720	missense	probably damaging	0.99
R6020:Pygl	UTSW	12	70216654	missense	probably damaging	1.00
R6024:Pygl	UTSW	12	70197067	missense	probably benign	0.09
R7050:Pygl	UTSW	12	70219622	missense	probably damaging	1.00
R7159:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R7194:Pygl	UTSW	12	70194320	missense	probably benign
R7283:Pygl	UTSW	12	70216568	missense	possibly damaging	0.92
R7360:Pygl	UTSW	12	70227532	missense	probably benign	0.11
R7446:Pygl	UTSW	12	70197010	missense	probably benign
R7637:Pygl	UTSW	12	70197795	splice site	probably null
R8054:Pygl	UTSW	12	70227339	critical splice donor site	probably null
R8693:Pygl	UTSW	12	70197406	missense	probably benign	0.41
R8753:Pygl	UTSW	12	70195626	missense	probably damaging	1.00
R8803:Pygl	UTSW	12	70195616	missense	probably damaging	1.00
R8842:Pygl	UTSW	12	70227594	intron	probably benign
R9192:Pygl	UTSW	12	70197048	missense	probably damaging	0.99
R9221:Pygl	UTSW	12	70195627	missense	probably damaging	1.00
R9437:Pygl	UTSW	12	70200151	missense	probably damaging	1.00
R9750:Pygl	UTSW	12	70198529	missense	possibly damaging	0.68
Z1176:Pygl	UTSW	12	70222874	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GGACACAGAATCAGCCTTCC -3'
(R):5'- TGAAGGACATTGGCTGAGACC -3'

Sequencing Primer
(F):5'- CATCTATGGAGCTTCCCAATTGATG -3'
(R):5'- CATTGGCTGAGACCAAGGGAC -3'

Posted On

2020-06-10