Incidental Mutation 'R7754:Nlgn1'
ID597425
Institutional Source Beutler Lab
Gene Symbol Nlgn1
Ensembl Gene ENSMUSG00000063887
Gene Nameneuroligin 1
SynonymsNL1, Nlg1, 6330415N05Rik
Accession Numbers

Ncbi RefSeq: NM_138666.3; NM_001163387.1; MGI:2179435

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7754 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location25426215-26332460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25434303 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 623 (V623I)
Ref Sequence ENSEMBL: ENSMUSP00000142200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075054] [ENSMUST00000108308] [ENSMUST00000191835] [ENSMUST00000193603]
PDB Structure
Crystal structure of a synaptic adhesion complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000075054
AA Change: V623I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074565
Gene: ENSMUSG00000063887
AA Change: V623I

DomainStartEndE-ValueType
Pfam:COesterase 29 626 4.8e-199 PFAM
Pfam:Abhydrolase_3 196 302 2.2e-8 PFAM
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 720 731 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 816 827 N/A INTRINSIC
low complexity region 829 839 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108308
AA Change: V594I

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103944
Gene: ENSMUSG00000063887
AA Change: V594I

DomainStartEndE-ValueType
Pfam:COesterase 29 597 2.5e-190 PFAM
Pfam:Abhydrolase_3 176 306 4.3e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191835
AA Change: V594I

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142086
Gene: ENSMUSG00000063887
AA Change: V594I

DomainStartEndE-ValueType
Pfam:COesterase 29 597 2.5e-190 PFAM
Pfam:Abhydrolase_3 176 306 4.3e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193603
AA Change: V623I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142200
Gene: ENSMUSG00000063887
AA Change: V623I

DomainStartEndE-ValueType
Pfam:COesterase 29 626 1.2e-186 PFAM
Pfam:Abhydrolase_3 196 309 3.7e-8 PFAM
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 720 731 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 816 827 N/A INTRINSIC
low complexity region 829 839 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype Strain: 3687638
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but display impaired NMDA receptor-mediated synaptic transmission onto CA1 pyramidal cells. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,304,843 probably null Het
2410089E03Rik C A 15: 8,243,826 Q2534K possibly damaging Het
4930553M12Rik A T 4: 88,868,259 W41R unknown Het
Aatf G A 11: 84,511,509 S117L possibly damaging Het
Abca12 C A 1: 71,302,887 V972L probably benign Het
Abcb11 T A 2: 69,286,818 R495S probably damaging Het
Acss2 T A 2: 155,561,166 H621Q probably benign Het
Akap9 T C 5: 4,046,736 L2537P probably benign Het
Apbb1 C T 7: 105,559,302 A597T probably damaging Het
Cacna1d A T 14: 30,075,852 I1448N probably damaging Het
Cacna1e C T 1: 154,413,117 E1841K probably damaging Het
Ccdc162 G T 10: 41,587,375 P1457Q probably damaging Het
Cep70 A G 9: 99,281,092 K331E probably damaging Het
D430041D05Rik A T 2: 104,257,159 Y491N probably benign Het
Dnah6 T C 6: 73,025,720 I3898V probably benign Het
Drd2 A G 9: 49,404,977 T346A probably benign Het
Efcab9 T C 11: 32,522,941 T169A possibly damaging Het
Fam163a A T 1: 156,079,983 I21N probably damaging Het
Fam171a2 C T 11: 102,438,563 D457N probably benign Het
Fbn1 A T 2: 125,479,280 probably null Het
Gpr37 A T 6: 25,689,050 L16H probably damaging Het
Gtf3c2 T C 5: 31,172,831 D265G probably benign Het
Idh1 G T 1: 65,159,490 A407D probably benign Het
Ifna12 A G 4: 88,603,178 M44T probably damaging Het
Il22ra1 A G 4: 135,734,250 M109V probably benign Het
Jag2 A T 12: 112,915,469 probably null Het
Lca5l T C 16: 96,159,561 D572G unknown Het
Lcn11 G A 2: 25,777,818 V73I probably benign Het
Lrba A G 3: 86,445,397 T1951A probably damaging Het
Ltbp2 A G 12: 84,813,238 probably null Het
Malrd1 G A 2: 15,797,799 probably null Het
Morc2b C A 17: 33,137,244 G518V probably benign Het
Muc5ac G C 7: 141,809,303 G2117A unknown Het
Myo5b A T 18: 74,634,559 T313S probably benign Het
Neto2 C A 8: 85,669,700 L140F probably damaging Het
Olfr364-ps1 A G 2: 37,146,846 I211M possibly damaging Het
Olfr371 T A 8: 85,230,798 M101K possibly damaging Het
Olfr384 C T 11: 73,603,506 Q309* probably null Het
Olfr603 C A 7: 103,383,738 W88L probably damaging Het
Olfr825 T G 10: 130,162,829 T166P probably damaging Het
Optc A G 1: 133,906,992 S15P possibly damaging Het
Otogl A G 10: 107,869,546 V640A probably damaging Het
Pcdhgb2 T C 18: 37,689,970 S5P probably benign Het
Pde3a A T 6: 141,459,249 E400V probably benign Het
Pkhd1l1 A G 15: 44,586,408 I3856V possibly damaging Het
Pld2 G A 11: 70,552,869 probably null Het
Plxna4 G T 6: 32,152,872 H1839N probably damaging Het
Ppp6r2 T C 15: 89,256,701 V89A probably benign Het
Rapgef3 T C 15: 97,757,746 D420G probably damaging Het
Rnf17 T A 14: 56,462,072 probably null Het
Rps6ka2 T A 17: 7,277,449 probably null Het
Rptn A T 3: 93,395,921 D187V probably damaging Het
Rtn1 T C 12: 72,308,429 K248E probably damaging Het
Rtn4rl1 A T 11: 75,265,045 H101L probably benign Het
Sept3 A G 15: 82,290,773 N305S probably benign Het
Serpina3f G T 12: 104,217,306 K142N possibly damaging Het
Ssh1 C A 5: 113,966,234 R116L probably benign Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tlr6 T C 5: 64,954,350 K405E possibly damaging Het
Trbv13-2 G A 6: 41,121,700 A70T probably benign Het
Ttn A T 2: 76,788,196 I16248N probably damaging Het
Ttn A T 2: 76,825,505 probably null Het
Vldlr A T 19: 27,217,615 M1L probably benign Het
Wscd1 A G 11: 71,784,365 H366R probably damaging Het
Zbtb8a A G 4: 129,357,703 probably null Het
Zfp827 T C 8: 79,190,329 V511A Het
Other mutations in Nlgn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Nlgn1 APN 3 25436490 missense probably benign 0.02
IGL00543:Nlgn1 APN 3 25433781 missense probably damaging 1.00
IGL00960:Nlgn1 APN 3 25912697 missense probably damaging 1.00
IGL01533:Nlgn1 APN 3 25436363 missense possibly damaging 0.69
IGL02146:Nlgn1 APN 3 25912682 missense probably damaging 0.96
IGL02616:Nlgn1 APN 3 25434245 missense probably damaging 0.99
IGL03342:Nlgn1 APN 3 26133262 missense probably damaging 1.00
P0018:Nlgn1 UTSW 3 25436577 missense probably damaging 1.00
R0010:Nlgn1 UTSW 3 25435842 splice site probably benign
R0010:Nlgn1 UTSW 3 25435842 splice site probably benign
R0123:Nlgn1 UTSW 3 25435925 missense probably damaging 1.00
R0134:Nlgn1 UTSW 3 25435925 missense probably damaging 1.00
R0294:Nlgn1 UTSW 3 26133476 missense probably benign 0.23
R0798:Nlgn1 UTSW 3 25434246 missense probably benign 0.05
R1051:Nlgn1 UTSW 3 25912705 missense probably damaging 0.98
R1116:Nlgn1 UTSW 3 25433874 missense probably benign 0.00
R1289:Nlgn1 UTSW 3 25434236 missense possibly damaging 0.87
R1522:Nlgn1 UTSW 3 25435909 missense probably damaging 1.00
R1550:Nlgn1 UTSW 3 25912644 missense probably damaging 1.00
R1669:Nlgn1 UTSW 3 25436134 missense probably damaging 1.00
R1853:Nlgn1 UTSW 3 26133522 missense possibly damaging 0.80
R1856:Nlgn1 UTSW 3 25440037 nonsense probably null
R1935:Nlgn1 UTSW 3 26331790 utr 5 prime probably benign
R1936:Nlgn1 UTSW 3 26331790 utr 5 prime probably benign
R1952:Nlgn1 UTSW 3 25436300 missense probably damaging 1.00
R1953:Nlgn1 UTSW 3 25436300 missense probably damaging 1.00
R2004:Nlgn1 UTSW 3 25433870 missense probably benign 0.29
R2114:Nlgn1 UTSW 3 26133265 missense probably damaging 1.00
R2116:Nlgn1 UTSW 3 26133265 missense probably damaging 1.00
R2198:Nlgn1 UTSW 3 25433761 missense probably damaging 0.99
R2994:Nlgn1 UTSW 3 25435998 missense probably damaging 1.00
R3056:Nlgn1 UTSW 3 25433696 missense possibly damaging 0.53
R4190:Nlgn1 UTSW 3 25433898 missense probably benign
R4196:Nlgn1 UTSW 3 25434392 missense probably damaging 1.00
R4613:Nlgn1 UTSW 3 25436022 missense probably benign 0.01
R4654:Nlgn1 UTSW 3 26133701 missense possibly damaging 0.51
R4757:Nlgn1 UTSW 3 25436168 missense probably damaging 1.00
R4757:Nlgn1 UTSW 3 25436343 missense possibly damaging 0.63
R4815:Nlgn1 UTSW 3 25436030 missense probably damaging 0.99
R4884:Nlgn1 UTSW 3 25912674 missense probably damaging 1.00
R4966:Nlgn1 UTSW 3 25920237 missense possibly damaging 0.65
R5119:Nlgn1 UTSW 3 25433794 missense probably damaging 0.99
R5842:Nlgn1 UTSW 3 26133743 unclassified probably null
R6218:Nlgn1 UTSW 3 25436093 missense probably damaging 1.00
R6397:Nlgn1 UTSW 3 25433663 missense possibly damaging 0.53
R6500:Nlgn1 UTSW 3 25433930 missense possibly damaging 0.84
R6822:Nlgn1 UTSW 3 26133647 missense probably benign 0.00
R6846:Nlgn1 UTSW 3 25436342 missense probably damaging 0.99
R7047:Nlgn1 UTSW 3 25436035 nonsense probably null
R7147:Nlgn1 UTSW 3 26133360 missense probably benign 0.02
R7886:Nlgn1 UTSW 3 25435907 missense probably damaging 1.00
R7969:Nlgn1 UTSW 3 25435907 missense probably damaging 1.00
Z1176:Nlgn1 UTSW 3 25436604 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TCTGATCCACCGAGAAGGGG -3'
(R):5'- GTTTCCTCACAGATTCTTGCTTG -3'

Sequencing Primer
(F):5'- CACCGAGAAGGGGCTTGG -3'
(R):5'- ACAGATTCTTGCTTGTCTTCCCAC -3'
Posted On2019-11-26