Incidental Mutation 'R8036:Kctd13'
ID618243
Institutional Source Beutler Lab
Gene Symbol Kctd13
Ensembl Gene ENSMUSG00000030685
Gene Namepotassium channel tetramerisation domain containing 13
SynonymsPdip1, Poldip1, 1500003N18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8036 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126928879-126945631 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126929242 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 63 (D63G)
Ref Sequence ENSEMBL: ENSMUSP00000032924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032924]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032924
AA Change: D63G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032924
Gene: ENSMUSG00000030685
AA Change: D63G

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 18 32 N/A INTRINSIC
BTB 41 141 6.48e-15 SMART
low complexity region 276 314 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced synaptic transmission, abnormal hippocampal pyramidal neuron dendrite morphology, and hyperactivity with no detectable changes in body weight, brain size or neurogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,678,177 I181F probably damaging Het
Abcc3 A G 11: 94,345,992 V1473A possibly damaging Het
Akap9 T A 5: 4,070,397 C3604* probably null Het
Alas1 A G 9: 106,235,522 I545T probably benign Het
Anpep A C 7: 79,841,898 D118E probably benign Het
Arhgef17 A T 7: 100,929,855 S629T probably damaging Het
Arid2 C T 15: 96,368,744 R558C probably damaging Het
Camk2n1 A G 4: 138,456,745 D65G probably damaging Het
Ccdc114 A G 7: 45,942,852 D352G probably benign Het
Ccdc177 T C 12: 80,758,123 N459S unknown Het
Cenpe ACTCTCT ACTCT 3: 135,239,848 probably null Het
Crb1 T C 1: 139,237,384 I1062V probably benign Het
Decr2 A G 17: 26,082,988 L256P probably damaging Het
Dhx37 T C 5: 125,424,675 M507V probably benign Het
Disp1 A G 1: 183,089,239 I539T probably damaging Het
Dqx1 T A 6: 83,059,807 V264E probably damaging Het
Enpp4 A G 17: 44,102,245 S133P possibly damaging Het
Fam149a T C 8: 45,349,011 T476A probably benign Het
Fam20b A G 1: 156,705,837 W70R probably damaging Het
Fbxl13 T A 5: 21,523,568 N508Y probably damaging Het
Fjx1 A G 2: 102,450,375 L405P probably damaging Het
Fn1 G A 1: 71,590,151 Q2399* probably null Het
Foxa2 G C 2: 148,043,989 T308S probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm10521 A G 1: 171,896,185 D21G unknown Het
Gstcd C T 3: 133,082,107 V277M probably damaging Het
Herpud1 A G 8: 94,392,386 E256G probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Lamp3 C A 16: 19,701,059 D125Y probably damaging Het
Luzp2 A G 7: 55,075,075 D128G probably damaging Het
Lyve1 A G 7: 110,859,442 C105R probably damaging Het
Mlkl A T 8: 111,333,454 V100E probably damaging Het
Muc5b T C 7: 141,867,741 S4323P possibly damaging Het
Myoz3 T G 18: 60,580,850 probably null Het
Nlrp9c T A 7: 26,371,439 N906Y possibly damaging Het
Olfr1132 C T 2: 87,635,503 M81I probably benign Het
Olfr248 A G 1: 174,391,816 H249R probably damaging Het
Olfr564 A T 7: 102,803,556 H26L possibly damaging Het
Olfr913 T C 9: 38,594,890 F223S probably benign Het
Pcsk9 G A 4: 106,454,339 H232Y possibly damaging Het
Plec A G 15: 76,179,180 I2230T possibly damaging Het
Pou2f3 T A 9: 43,146,908 T47S probably damaging Het
Rab8a A T 8: 72,174,595 I106F probably damaging Het
Ros1 A T 10: 52,165,343 S295T probably benign Het
Sh3yl1 T A 12: 30,942,099 N222K possibly damaging Het
Slc6a9 C T 4: 117,867,886 A559V possibly damaging Het
Spata20 T G 11: 94,479,137 I778L probably benign Het
Taar1 A T 10: 23,921,135 T244S probably benign Het
Tmem229b C A 12: 78,965,088 C23F probably damaging Het
Ttll4 A G 1: 74,679,230 Y80C probably benign Het
Ube2m G A 7: 13,035,639 T176I probably benign Het
Zfp790 G A 7: 29,828,921 A344T possibly damaging Het
Zfp90 G A 8: 106,419,128 V31M probably benign Het
Zswim4 C T 8: 84,223,289 R659Q probably benign Het
Other mutations in Kctd13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02617:Kctd13 APN 7 126942332 missense possibly damaging 0.64
IGL02890:Kctd13 APN 7 126930731 missense probably benign 0.01
IGL03339:Kctd13 APN 7 126945018 missense probably benign
R5322:Kctd13 UTSW 7 126929206 missense probably damaging 1.00
R6365:Kctd13 UTSW 7 126930690 missense probably damaging 1.00
R7585:Kctd13 UTSW 7 126929286 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GGGGCAAAGGATCCTTTAGACG -3'
(R):5'- GCGCTTGGCAGATGTTACTG -3'

Sequencing Primer
(F):5'- GTCCGCTCACTGGCATGTC -3'
(R):5'- ATGTTACTGCTGGAAGTAAAGGATTG -3'
Posted On2020-01-23