Incidental Mutation 'R8055:Esco2'
ID619338
Institutional Source Beutler Lab
Gene Symbol Esco2
Ensembl Gene ENSMUSG00000022034
Gene Nameestablishment of sister chromatid cohesion N-acetyltransferase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8055 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location65819038-65833994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65831719 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 47 (N47K)
Ref Sequence ENSEMBL: ENSMUSP00000022613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022613] [ENSMUST00000225853]
Predicted Effect probably benign
Transcript: ENSMUST00000022613
AA Change: N47K

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022613
Gene: ENSMUSG00000022034
AA Change: N47K

DomainStartEndE-ValueType
low complexity region 139 156 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:zf-C2H2_3 371 410 1.6e-18 PFAM
Pfam:Acetyltransf_13 520 588 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225853
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may have acetyltransferase activity and may be required for the establishment of sister chromatid cohesion during the S phase of mitosis. Mutations in this gene have been associated with Roberts syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation associated with impaired chromosome cohesion and abnormal mitosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 A T 3: 107,668,731 D353E probably benign Het
Alk G T 17: 71,899,257 P1033T probably benign Het
Asb15 G T 6: 24,556,566 C20F probably benign Het
BC049715 A G 6: 136,839,915 N51S possibly damaging Het
Ccser1 G A 6: 61,313,773 V480M possibly damaging Het
Cep295 T C 9: 15,333,609 N1184D probably benign Het
Cers6 C T 2: 68,947,281 R111W probably damaging Het
Clybl T A 14: 122,377,861 D204E probably damaging Het
Cxcl13 T C 5: 95,959,904 V73A probably benign Het
Dchs2 A G 3: 83,129,725 N593S probably benign Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fmo4 T C 1: 162,808,446 T46A probably benign Het
Gm15217 T C 14: 46,379,454 probably benign Het
Gm9774 C A 3: 92,428,832 G188W unknown Het
Gnb5 G T 9: 75,343,544 A317S probably benign Het
Klf14 A G 6: 30,957,787 V304A probably benign Het
Klrc2 A T 6: 129,656,461 C209* probably null Het
Kmt2a A T 9: 44,821,081 N2646K unknown Het
Krt14 C G 11: 100,204,758 V274L possibly damaging Het
Myo16 A T 8: 10,562,186 D1277V unknown Het
Myo9a A T 9: 59,907,460 E2226D probably damaging Het
Osbpl8 T C 10: 111,284,394 V631A possibly damaging Het
Piezo2 G A 18: 63,042,811 S1833L probably damaging Het
Pkp4 T C 2: 59,308,015 V203A probably benign Het
Primpol T C 8: 46,579,162 D459G probably benign Het
Prkdc G T 16: 15,816,885 R3631S probably benign Het
Rbbp8nl T C 2: 180,278,208 T558A probably benign Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rdx G A 9: 52,086,424 R566Q probably damaging Het
Rhbdf2 A C 11: 116,607,365 S3A probably benign Het
Rpap1 A T 2: 119,764,803 I1319N probably benign Het
Sbno2 T A 10: 80,069,431 I206F possibly damaging Het
Scn1a A G 2: 66,319,501 V944A probably damaging Het
Scube1 C T 15: 83,659,025 probably null Het
Slc22a20 G A 19: 5,971,411 A521V probably benign Het
Slc6a4 C A 11: 77,010,598 T53K probably benign Het
Snapc2 G A 8: 4,254,322 R75Q probably damaging Het
Sptan1 A T 2: 29,994,339 K662I probably benign Het
Sycp3 T C 10: 88,462,576 S55P probably damaging Het
Tet2 A T 3: 133,467,992 V1503D possibly damaging Het
Tfrc T A 16: 32,618,656 N277K probably benign Het
Tlx3 A T 11: 33,201,283 V291E probably damaging Het
Tnk1 A T 11: 69,856,501 H101Q probably benign Het
Tns3 A T 11: 8,545,343 D70E probably damaging Het
Trip11 C A 12: 101,837,665 G1938C probably damaging Het
Tubg1 T C 11: 101,124,002 L190P probably damaging Het
Vmn2r79 A T 7: 87,037,333 S641C possibly damaging Het
Wnt8b A G 19: 44,493,513 probably benign Het
Other mutations in Esco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01569:Esco2 APN 14 65826528 missense probably benign 0.00
IGL01613:Esco2 APN 14 65826595 missense possibly damaging 0.75
IGL02148:Esco2 APN 14 65826595 missense probably benign 0.00
IGL03039:Esco2 APN 14 65831418 missense probably damaging 0.97
PIT4508001:Esco2 UTSW 14 65831465 missense probably damaging 0.99
R0400:Esco2 UTSW 14 65831706 missense possibly damaging 0.73
R0894:Esco2 UTSW 14 65827277 missense probably benign 0.35
R1778:Esco2 UTSW 14 65831262 missense possibly damaging 0.47
R1795:Esco2 UTSW 14 65827277 missense probably benign 0.35
R1962:Esco2 UTSW 14 65831533 missense probably damaging 1.00
R2325:Esco2 UTSW 14 65826578 splice site probably null
R2357:Esco2 UTSW 14 65826551 missense probably benign 0.32
R2369:Esco2 UTSW 14 65821740 missense probably damaging 1.00
R4659:Esco2 UTSW 14 65826586 missense possibly damaging 0.92
R5648:Esco2 UTSW 14 65831192 missense probably damaging 1.00
R5873:Esco2 UTSW 14 65824191 missense probably benign 0.00
R6782:Esco2 UTSW 14 65820016 missense probably benign 0.00
R6877:Esco2 UTSW 14 65831045 missense probably benign 0.01
R7116:Esco2 UTSW 14 65826557 missense probably damaging 1.00
R7572:Esco2 UTSW 14 65831192 missense probably damaging 0.97
R7645:Esco2 UTSW 14 65827181 missense probably benign 0.08
R8072:Esco2 UTSW 14 65832681 missense probably benign
R8483:Esco2 UTSW 14 65831669 missense probably benign 0.00
Z1177:Esco2 UTSW 14 65824936 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATCAACTTCCTCTCGAGTGGATTG -3'
(R):5'- ATAATGTGTCAAACAATGGCGG -3'

Sequencing Primer
(F):5'- CCTCTCGAGTGGATTGAGGTAG -3'
(R):5'- TCAAACAATGGCGGGGGATG -3'
Posted On2020-01-23