Incidental Mutation 'R8071:Lrrc27'
ID628918
Institutional Source Beutler Lab
Gene Symbol Lrrc27
Ensembl Gene ENSMUSG00000015980
Gene Nameleucine rich repeat containing 27
Synonyms1700071K18Rik, 2310044E02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8071 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location139212988-139242979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139236986 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 433 (I433M)
Ref Sequence ENSEMBL: ENSMUSP00000016124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016124]
Predicted Effect probably benign
Transcript: ENSMUST00000016124
AA Change: I433M

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000016124
Gene: ENSMUSG00000015980
AA Change: I433M

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
LRR_TYP 75 98 1.03e-2 SMART
LRR_TYP 99 122 3.69e-4 SMART
LRR 123 145 7.38e1 SMART
low complexity region 271 283 N/A INTRINSIC
coiled coil region 336 370 N/A INTRINSIC
coiled coil region 463 491 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C A 1: 37,623,929 E963* probably null Het
Acads T C 5: 115,113,167 E86G probably benign Het
Agmo A G 12: 37,398,729 T217A probably damaging Het
Arhgap39 A G 15: 76,737,502 S300P probably benign Het
Casp12 T C 9: 5,346,647 L58P probably damaging Het
Ccar2 T C 14: 70,152,453 T24A probably benign Het
Ccndbp1 C A 2: 121,014,565 T321K unknown Het
Cd200r3 G A 16: 44,954,140 C172Y probably damaging Het
Chd2 T A 7: 73,537,384 H9L probably benign Het
Cramp1l T A 17: 24,982,700 S603C probably damaging Het
Crtac1 C T 19: 42,297,800 R448H probably damaging Het
Csmd2 A T 4: 128,393,538 Y1022F Het
Ctns T C 11: 73,184,934 Y363C probably damaging Het
D630044L22Rik A G 17: 25,960,144 T15A possibly damaging Het
Dhx38 A C 8: 109,558,701 I444M probably benign Het
Dnah14 A T 1: 181,615,894 I450F possibly damaging Het
Dpf1 T C 7: 29,314,141 F245L probably benign Het
Efr3b A G 12: 3,982,898 V269A probably benign Het
Eprs G T 1: 185,394,456 V530L possibly damaging Het
Eps8l2 A G 7: 141,342,947 N41S probably damaging Het
Erbb4 T C 1: 68,396,311 I142M probably damaging Het
Fam160a1 T C 3: 85,730,561 M144V probably damaging Het
Flnc A T 6: 29,457,446 D2381V probably damaging Het
Fndc1 T A 17: 7,772,530 D778V unknown Het
Galnt3 A G 2: 66,091,211 I492T probably benign Het
Gigyf2 T C 1: 87,446,433 M1261T probably damaging Het
Haus8 A G 8: 71,256,051 F126S probably benign Het
Hif3a A G 7: 17,048,761 L293S probably damaging Het
Ino80c G A 18: 24,106,650 T200I unknown Het
Jag1 T A 2: 137,101,797 M160L probably benign Het
Kcnj12 C A 11: 61,069,999 H374Q probably damaging Het
Lyzl4 C T 9: 121,578,094 W123* probably null Het
Map2k4 A T 11: 65,707,001 C264S Het
Mmrn1 C T 6: 60,944,524 probably benign Het
Mug1 C T 6: 121,873,672 T709I probably benign Het
Myo9a T A 9: 59,874,648 W1706R probably benign Het
Nlrp5 A G 7: 23,418,444 E531G probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Pcdhb11 A C 18: 37,422,369 I251L probably benign Het
Per3 A G 4: 151,028,813 S353P probably damaging Het
Piezo1 T C 8: 122,487,011 E1738G probably null Het
Prr14l T C 5: 32,831,164 D329G probably benign Het
Ptpn23 G T 9: 110,388,199 P863Q probably damaging Het
Ptpn23 G T 9: 110,388,200 P863T possibly damaging Het
Ptprq T C 10: 107,644,035 K1125E possibly damaging Het
Rapgef2 T G 3: 79,093,036 T351P probably damaging Het
Rbl2 A G 8: 91,113,989 Y923C probably damaging Het
Rimbp3 T C 16: 17,210,863 V717A probably benign Het
Rims1 C T 1: 22,288,536 W182* probably null Het
Rnmt A G 18: 68,307,652 K129E probably benign Het
Ruvbl1 T C 6: 88,473,126 F93S probably damaging Het
Scamp5 T C 9: 57,443,686 Y231C probably damaging Het
Sfxn5 T A 6: 85,267,939 probably null Het
Skiv2l A T 17: 34,849,999 V8D probably benign Het
Slc12a1 T C 2: 125,186,314 F510S probably damaging Het
Sowahb T C 5: 93,043,063 Y599C probably damaging Het
Speer4e T C 5: 14,937,097 N98S probably damaging Het
Stat3 T C 11: 100,893,981 N553S probably benign Het
Sult6b2 A T 6: 142,790,142 L242Q probably damaging Het
Tacc3 C T 5: 33,663,825 R98W possibly damaging Het
Tuba4a C T 1: 75,216,951 R112H Het
Ubr3 T A 2: 69,988,876 S1337T probably damaging Het
Vmn2r69 A T 7: 85,406,505 C808* probably null Het
Wnt16 G A 6: 22,288,998 A105T probably benign Het
Zfp692 C T 11: 58,307,734 S50L probably damaging Het
Other mutations in Lrrc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Lrrc27 APN 7 139227911 intron probably benign
IGL02095:Lrrc27 APN 7 139230253 missense probably benign 0.04
IGL02489:Lrrc27 APN 7 139226061 missense probably benign 0.01
IGL03080:Lrrc27 APN 7 139230237 missense probably benign 0.03
R0372:Lrrc27 UTSW 7 139226187 missense probably benign 0.17
R1466:Lrrc27 UTSW 7 139230308 unclassified probably benign
R2401:Lrrc27 UTSW 7 139223613 missense probably damaging 1.00
R2876:Lrrc27 UTSW 7 139228684 intron probably benign
R3113:Lrrc27 UTSW 7 139218307 missense probably damaging 1.00
R4214:Lrrc27 UTSW 7 139223693 missense probably damaging 1.00
R4707:Lrrc27 UTSW 7 139242698 missense probably benign 0.02
R4784:Lrrc27 UTSW 7 139242698 missense probably benign 0.02
R5070:Lrrc27 UTSW 7 139214799 missense probably damaging 0.99
R5855:Lrrc27 UTSW 7 139218335 unclassified probably benign
R6408:Lrrc27 UTSW 7 139218268 missense probably benign 0.14
R6993:Lrrc27 UTSW 7 139242624 missense probably damaging 0.99
R7332:Lrrc27 UTSW 7 139242745 missense probably damaging 1.00
R7350:Lrrc27 UTSW 7 139226106 missense probably benign 0.01
R7460:Lrrc27 UTSW 7 139223658 missense probably damaging 1.00
R7502:Lrrc27 UTSW 7 139214832 missense probably benign
R8020:Lrrc27 UTSW 7 139236877 missense probably damaging 1.00
R8518:Lrrc27 UTSW 7 139228774 missense probably benign 0.01
RF018:Lrrc27 UTSW 7 139226100 missense probably benign 0.03
X0065:Lrrc27 UTSW 7 139230245 missense probably benign 0.00
X0065:Lrrc27 UTSW 7 139230246 missense probably benign 0.00
Z1176:Lrrc27 UTSW 7 139242720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTAAAGAATGTCCCCTCCTCTG -3'
(R):5'- CTGCAGGGGAGTCTTCTAAG -3'

Sequencing Primer
(F):5'- AAAGAATGTCCCCTCCTCTGTGTAG -3'
(R):5'- CTAAGACTTCCTGATCATCTGGTAGG -3'
Posted On2020-06-30