Incidental Mutation 'R8084:Cracr2a'
ID 629512
Institutional Source Beutler Lab
Gene Symbol Cracr2a
Ensembl Gene ENSMUSG00000061414
Gene Name calcium release activated channel regulator 2A
Synonyms LOC243645, Efcab4b, LOC381812
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8084 (G1)
Quality Score 213.009
Status Validated
Chromosome 6
Chromosomal Location 127561338-127674248 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127639172 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 370 (N370S)
Ref Sequence ENSEMBL: ENSMUSP00000148569 (fasta)
AlphaFold Q3UP38
Predicted Effect probably benign
Transcript: ENSMUST00000212051
AA Change: N370S

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 98.9%
  • 20x: 96.2%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,433,967 Y190N probably benign Het
Acsl3 G A 1: 78,692,127 D238N probably damaging Het
Acss1 T A 2: 150,642,781 I181F probably damaging Het
Ano5 A G 7: 51,579,539 I610V probably benign Het
Anxa6 A T 11: 55,004,008 F256I probably damaging Het
Ash2l A G 8: 25,831,294 S273P probably benign Het
Baz2b T G 2: 59,962,236 E516A probably benign Het
Bbs2 G T 8: 94,087,428 D187E probably damaging Het
Cacna1b T A 2: 24,685,796 M747L probably benign Het
Cacna2d4 C A 6: 119,300,352 D675E probably damaging Het
Calcr G A 6: 3,687,615 T461M probably benign Het
Catip A G 1: 74,364,356 K126E probably damaging Het
Chga T C 12: 102,562,069 I273T probably benign Het
Clasp2 G A 9: 113,847,755 V185I probably benign Het
Crygc A T 1: 65,071,822 V102D probably benign Het
Ddx23 A G 15: 98,658,264 S58P unknown Het
Dlgap5 C T 14: 47,407,841 G281D probably benign Het
Dnah5 A T 15: 28,387,953 Y3186F probably damaging Het
Dpp6 A C 5: 27,631,399 I296L probably benign Het
Elfn2 C T 15: 78,672,460 R629H probably damaging Het
Eml2 G T 7: 19,181,224 probably null Het
Fitm1 T A 14: 55,576,449 V134E probably damaging Het
Flnb A G 14: 7,907,243 N1272S probably benign Het
Fuca1 G A 4: 135,934,803 W347* probably null Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gls2 G A 10: 128,199,256 R86H probably damaging Het
Grin2b T C 6: 135,733,488 K1020R probably benign Het
H2-DMb1 T A 17: 34,157,353 W149R probably damaging Het
Herc1 T A 9: 66,475,935 S3629R probably benign Het
Itih4 A T 14: 30,899,443 N821I possibly damaging Het
Kmt2d A T 15: 98,842,064 L4731Q unknown Het
Loxhd1 A T 18: 77,340,149 I472F possibly damaging Het
Lrp2 C A 2: 69,509,369 C1066F probably damaging Het
Mllt10 T A 2: 18,109,826 F114I probably damaging Het
Mpp5 A T 12: 78,820,851 Q336L probably benign Het
N4bp1 T C 8: 86,861,008 E434G probably benign Het
N6amt1 T C 16: 87,354,340 F30L probably damaging Het
Naca G A 10: 128,041,531 V811I unknown Het
Nobox A C 6: 43,305,167 I324S possibly damaging Het
Nup210l T C 3: 90,136,058 S442P probably benign Het
Olfr791 A T 10: 129,526,940 T238S probably damaging Het
Osbpl1a A T 18: 12,905,042 L284Q probably damaging Het
Pcdhb20 A C 18: 37,506,173 Y584S possibly damaging Het
Pgpep1l A T 7: 68,237,771 F27Y probably benign Het
Pik3cg T G 12: 32,195,688 I854L probably benign Het
Pot1a C T 6: 25,771,536 V229M possibly damaging Het
Prh1 C T 6: 132,571,859 P110S unknown Het
Prkag3 C T 1: 74,747,207 C193Y probably damaging Het
Prl2c5 T C 13: 13,185,954 F69L probably benign Het
Ptprq T C 10: 107,608,433 T1437A probably benign Het
Rabgap1 T C 2: 37,537,305 Y633H probably damaging Het
Rad54l2 G A 9: 106,713,502 T475I possibly damaging Het
Retreg1 C A 15: 25,969,799 A130E probably benign Het
Rps6kb1 G T 11: 86,535,436 H56N probably benign Het
Sars2 A G 7: 28,750,285 H385R probably damaging Het
Sbpl T G 17: 23,953,270 N225T unknown Het
Scml4 T C 10: 42,930,606 probably null Het
Scrib G A 15: 76,066,091 T302M probably benign Het
Sdk2 G A 11: 113,827,089 T1483I possibly damaging Het
Sh3bgrl3 A G 4: 134,128,079 S19P probably damaging Het
Slc10a6 C T 5: 103,612,461 V223I probably benign Het
Slc4a3 A G 1: 75,555,945 T950A probably benign Het
Spats2 A T 15: 99,167,080 D9V possibly damaging Het
Sphk1 A T 11: 116,535,078 probably null Het
Tex10 A T 4: 48,431,066 S897R probably benign Het
Tmco3 T C 8: 13,303,873 V395A probably damaging Het
Ttc7b A G 12: 100,384,173 L478P probably damaging Het
Ubac2 T C 14: 121,983,305 M184T probably benign Het
Wdr95 T C 5: 149,588,133 S433P probably damaging Het
Zfp202 T A 9: 40,211,242 H433Q probably benign Het
Zfp526 G T 7: 25,225,312 R332L probably damaging Het
Other mutations in Cracr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02136:Cracr2a APN 6 127629930 intron probably benign
PIT4812001:Cracr2a UTSW 6 127625870 missense probably damaging 1.00
R0111:Cracr2a UTSW 6 127604061 missense probably benign 0.00
R0180:Cracr2a UTSW 6 127604074 critical splice donor site probably null
R1612:Cracr2a UTSW 6 127603929 nonsense probably null
R1929:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2055:Cracr2a UTSW 6 127608601 nonsense probably null
R2270:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2272:Cracr2a UTSW 6 127607298 missense probably damaging 1.00
R2915:Cracr2a UTSW 6 127611505 missense probably damaging 0.98
R4476:Cracr2a UTSW 6 127629819 missense probably benign 0.18
R4600:Cracr2a UTSW 6 127603888 missense probably benign 0.00
R4767:Cracr2a UTSW 6 127611507 missense probably damaging 0.98
R5256:Cracr2a UTSW 6 127604029 missense probably damaging 1.00
R5657:Cracr2a UTSW 6 127604007 missense probably damaging 1.00
R5729:Cracr2a UTSW 6 127607236 missense possibly damaging 0.88
R6437:Cracr2a UTSW 6 127631831 missense probably damaging 0.96
R6572:Cracr2a UTSW 6 127608752 splice site probably null
R6851:Cracr2a UTSW 6 127608716 missense probably damaging 1.00
R7177:Cracr2a UTSW 6 127608706 missense probably benign 0.00
R7616:Cracr2a UTSW 6 127608697 nonsense probably null
R7809:Cracr2a UTSW 6 127649962 missense probably benign
R8030:Cracr2a UTSW 6 127611423 missense probably damaging 0.96
R8731:Cracr2a UTSW 6 127625927 critical splice donor site probably null
R8867:Cracr2a UTSW 6 127629773 nonsense probably null
Z1177:Cracr2a UTSW 6 127607244 missense probably benign 0.02
Z1177:Cracr2a UTSW 6 127669063 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGAGGCTGAGTGTTCCTC -3'
(R):5'- GGTCTGATTGTGCCAAGAGG -3'

Sequencing Primer
(F):5'- TGTTTGTCACAAGGCTACTCAG -3'
(R):5'- AAAAATGTTCTGTGTGTGGCTACC -3'
Posted On 2020-06-30