Mutagenetix > Incidental Mutation

Incidental Mutation 'R8084:Grin2b'

629514

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

067517-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8084 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135733488 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 1020 (K1020R)

Ref Sequence

ENSEMBL: ENSMUSP00000062284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053880
AA Change: K1020R

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: K1020R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111905
AA Change: K1020R

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: K1020R

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Coding Region Coverage

1x: 99.8%
3x: 99.7%
10x: 98.9%
20x: 96.2%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca2	T	A	2: 25,433,967	Y190N	probably benign	Het
Acsl3	G	A	1: 78,692,127	D238N	probably damaging	Het
Acss1	T	A	2: 150,642,781	I181F	probably damaging	Het
Ano5	A	G	7: 51,579,539	I610V	probably benign	Het
Anxa6	A	T	11: 55,004,008	F256I	probably damaging	Het
Ash2l	A	G	8: 25,831,294	S273P	probably benign	Het
Baz2b	T	G	2: 59,962,236	E516A	probably benign	Het
Bbs2	G	T	8: 94,087,428	D187E	probably damaging	Het
Cacna1b	T	A	2: 24,685,796	M747L	probably benign	Het
Cacna2d4	C	A	6: 119,300,352	D675E	probably damaging	Het
Calcr	G	A	6: 3,687,615	T461M	probably benign	Het
Catip	A	G	1: 74,364,356	K126E	probably damaging	Het
Chga	T	C	12: 102,562,069	I273T	probably benign	Het
Clasp2	G	A	9: 113,847,755	V185I	probably benign	Het
Cracr2a	A	G	6: 127,639,172	N370S	probably benign	Het
Crygc	A	T	1: 65,071,822	V102D	probably benign	Het
Ddx23	A	G	15: 98,658,264	S58P	unknown	Het
Dlgap5	C	T	14: 47,407,841	G281D	probably benign	Het
Dnah5	A	T	15: 28,387,953	Y3186F	probably damaging	Het
Dpp6	A	C	5: 27,631,399	I296L	probably benign	Het
Elfn2	C	T	15: 78,672,460	R629H	probably damaging	Het
Eml2	G	T	7: 19,181,224		probably null	Het
Fitm1	T	A	14: 55,576,449	V134E	probably damaging	Het
Flnb	A	G	14: 7,907,243	N1272S	probably benign	Het
Fuca1	G	A	4: 135,934,803	W347*	probably null	Het
Gabbr2	C	T	4: 46,736,349		probably null	Het
Gls2	G	A	10: 128,199,256	R86H	probably damaging	Het
H2-DMb1	T	A	17: 34,157,353	W149R	probably damaging	Het
Herc1	T	A	9: 66,475,935	S3629R	probably benign	Het
Itih4	A	T	14: 30,899,443	N821I	possibly damaging	Het
Kmt2d	A	T	15: 98,842,064	L4731Q	unknown	Het
Loxhd1	A	T	18: 77,340,149	I472F	possibly damaging	Het
Lrp2	C	A	2: 69,509,369	C1066F	probably damaging	Het
Mllt10	T	A	2: 18,109,826	F114I	probably damaging	Het
Mpp5	A	T	12: 78,820,851	Q336L	probably benign	Het
N4bp1	T	C	8: 86,861,008	E434G	probably benign	Het
N6amt1	T	C	16: 87,354,340	F30L	probably damaging	Het
Naca	G	A	10: 128,041,531	V811I	unknown	Het
Nobox	A	C	6: 43,305,167	I324S	possibly damaging	Het
Nup210l	T	C	3: 90,136,058	S442P	probably benign	Het
Olfr791	A	T	10: 129,526,940	T238S	probably damaging	Het
Osbpl1a	A	T	18: 12,905,042	L284Q	probably damaging	Het
Pcdhb20	A	C	18: 37,506,173	Y584S	possibly damaging	Het
Pgpep1l	A	T	7: 68,237,771	F27Y	probably benign	Het
Pik3cg	T	G	12: 32,195,688	I854L	probably benign	Het
Pot1a	C	T	6: 25,771,536	V229M	possibly damaging	Het
Prh1	C	T	6: 132,571,859	P110S	unknown	Het
Prkag3	C	T	1: 74,747,207	C193Y	probably damaging	Het
Prl2c5	T	C	13: 13,185,954	F69L	probably benign	Het
Ptprq	T	C	10: 107,608,433	T1437A	probably benign	Het
Rabgap1	T	C	2: 37,537,305	Y633H	probably damaging	Het
Rad54l2	G	A	9: 106,713,502	T475I	possibly damaging	Het
Retreg1	C	A	15: 25,969,799	A130E	probably benign	Het
Rps6kb1	G	T	11: 86,535,436	H56N	probably benign	Het
Sars2	A	G	7: 28,750,285	H385R	probably damaging	Het
Sbpl	T	G	17: 23,953,270	N225T	unknown	Het
Scml4	T	C	10: 42,930,606		probably null	Het
Scrib	G	A	15: 76,066,091	T302M	probably benign	Het
Sdk2	G	A	11: 113,827,089	T1483I	possibly damaging	Het
Sh3bgrl3	A	G	4: 134,128,079	S19P	probably damaging	Het
Slc10a6	C	T	5: 103,612,461	V223I	probably benign	Het
Slc4a3	A	G	1: 75,555,945	T950A	probably benign	Het
Spats2	A	T	15: 99,167,080	D9V	possibly damaging	Het
Sphk1	A	T	11: 116,535,078		probably null	Het
Tex10	A	T	4: 48,431,066	S897R	probably benign	Het
Tmco3	T	C	8: 13,303,873	V395A	probably damaging	Het
Ttc7b	A	G	12: 100,384,173	L478P	probably damaging	Het
Ubac2	T	C	14: 121,983,305	M184T	probably benign	Het
Wdr95	T	C	5: 149,588,133	S433P	probably damaging	Het
Zfp202	T	A	9: 40,211,242	H433Q	probably benign	Het
Zfp526	G	T	7: 25,225,312	R332L	probably damaging	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136044009	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9172:Grin2b	UTSW	6	135779257	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCCTCGATGTTGCCATAG -3'
(R):5'- AGCTTCACGCATTCAGACTGC -3'

Sequencing Primer
(F):5'- CCTCGATGTTGCCATAGGTGAC -3'
(R):5'- CCCTGTGAGGAAAACCTGTTCAG -3'

Posted On

2020-06-30