Incidental Mutation 'R8104:Olfr1357'
ID630652
Institutional Source Beutler Lab
Gene Symbol Olfr1357
Ensembl Gene ENSMUSG00000071185
Gene Nameolfactory receptor 1357
SynonymsMOR128-4, GA_x6K02T2QGN0-3196801-3197742, MOR128-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R8104 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78611003-78618074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78612408 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 78 (V78I)
Ref Sequence ENSEMBL: ENSMUSP00000093127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095473] [ENSMUST00000203305] [ENSMUST00000205085] [ENSMUST00000213877]
Predicted Effect probably benign
Transcript: ENSMUST00000095473
AA Change: V78I

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093127
Gene: ENSMUSG00000071185
AA Change: V78I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 215 2e-11 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203305
AA Change: V78I

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145032
Gene: ENSMUSG00000071185
AA Change: V78I

DomainStartEndE-ValueType
Pfam:7tm_4 31 235 1.3e-36 PFAM
Pfam:7TM_GPCR_Srsx 35 215 7.7e-11 PFAM
Pfam:7tm_1 41 234 3.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205085
AA Change: V78I

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000145185
Gene: ENSMUSG00000071185
AA Change: V78I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 215 2e-11 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213877
AA Change: V78I

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.6%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 C A 17: 56,845,443 L666F probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Apoc3 T G 9: 46,233,287 D79A probably damaging Het
Arfgap1 T A 2: 180,979,229 probably null Het
Ascc1 T C 10: 60,007,729 S38P probably benign Het
Asl C T 5: 130,011,950 E389K probably benign Het
Atat1 A T 17: 35,904,116 I215K probably benign Het
BC067074 T A 13: 113,319,729 F770I Het
Bod1l A T 5: 41,833,732 L160* probably null Het
Cbl C A 9: 44,158,539 S637I possibly damaging Het
Ccdc112 A C 18: 46,287,653 S343R probably benign Het
Cr1l A G 1: 195,117,617 S250P possibly damaging Het
Dlgap3 A G 4: 127,236,154 E907G probably damaging Het
Dsp A T 13: 38,168,624 E159D probably benign Het
Ech1 G A 7: 28,825,303 probably benign Het
Erbin G T 13: 103,834,977 N710K possibly damaging Het
Fbxw28 A T 9: 109,326,289 probably null Het
Gm4871 G C 5: 145,032,202 D100E probably damaging Het
Got1l1 A G 8: 27,197,591 I388T probably damaging Het
Ing5 T A 1: 93,816,444 N184K probably damaging Het
Izumo3 A T 4: 92,146,908 L24* probably null Het
Lig1 T C 7: 13,286,565 V99A possibly damaging Het
Mbtps1 A G 8: 119,529,055 Y488H possibly damaging Het
Muc5ac A G 7: 141,804,783 Y1240C possibly damaging Het
Nav3 T C 10: 109,758,967 T1458A probably damaging Het
Nedd1 T C 10: 92,691,916 E472G probably damaging Het
Nod2 A T 8: 88,665,057 H664L possibly damaging Het
Ntrk3 A G 7: 78,577,702 S28P probably damaging Het
Olfr298 A G 7: 86,489,023 F176S probably damaging Het
Olfr699 C A 7: 106,791,130 probably benign Het
Olfr699 T A 7: 106,791,131 probably benign Het
Olfr792 T A 10: 129,540,957 M140K probably benign Het
Pcdha4 G T 18: 36,954,053 G430W probably damaging Het
Pcnx T A 12: 81,983,611 Y1114* probably null Het
Pde6a T A 18: 61,231,494 D207E probably damaging Het
Plekhg1 T A 10: 3,952,326 I540N Het
Pnp2 A T 14: 50,959,642 I62F probably benign Het
Rarg C A 15: 102,239,899 D258Y probably damaging Het
Rnps1 T A 17: 24,424,510 M262K unknown Het
Scaf11 T C 15: 96,418,602 D1027G probably benign Het
Serpina3a A T 12: 104,112,851 probably benign Het
Slc25a1 A G 16: 17,926,433 probably null Het
Slc44a3 A C 3: 121,497,872 V365G probably benign Het
Slc45a3 T C 1: 131,977,016 F26L probably benign Het
Slc9a2 T A 1: 40,718,649 I116K probably damaging Het
Stk36 T A 1: 74,626,597 S700T probably benign Het
Tekt3 A G 11: 63,078,119 D224G probably benign Het
Tgtp1 A T 11: 48,987,014 I288N probably damaging Het
Ttn C T 2: 76,880,223 V8485M unknown Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Uso1 T A 5: 92,158,421 I79K probably damaging Het
Utp20 C T 10: 88,757,904 D2215N probably damaging Het
Wdr43 C T 17: 71,616,355 A32V probably benign Het
Zfp704 T C 3: 9,565,241 D170G probably benign Het
Other mutations in Olfr1357
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Olfr1357 APN 10 78612126 missense probably benign 0.02
IGL02201:Olfr1357 APN 10 78612270 missense probably damaging 0.96
IGL03029:Olfr1357 APN 10 78611958 missense probably benign 0.14
IGL03094:Olfr1357 APN 10 78612119 missense possibly damaging 0.80
R0207:Olfr1357 UTSW 10 78611871 missense probably benign
R0563:Olfr1357 UTSW 10 78612633 missense probably benign
R0745:Olfr1357 UTSW 10 78612122 missense probably benign 0.02
R1607:Olfr1357 UTSW 10 78612140 missense probably benign 0.08
R2419:Olfr1357 UTSW 10 78612387 missense probably benign 0.34
R4198:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4199:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4200:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4619:Olfr1357 UTSW 10 78612575 missense probably benign
R6152:Olfr1357 UTSW 10 78612575 missense probably benign
R6836:Olfr1357 UTSW 10 78612590 missense probably damaging 1.00
R6843:Olfr1357 UTSW 10 78612057 missense probably damaging 1.00
R7266:Olfr1357 UTSW 10 78612614 missense probably benign 0.07
Z1176:Olfr1357 UTSW 10 78612056 missense probably damaging 1.00
Z1177:Olfr1357 UTSW 10 78612151 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGTAGTGCGCAGACATGTGG -3'
(R):5'- CAGTCTTGGAATTCCATCTCATG -3'

Sequencing Primer
(F):5'- CAGACATGTGGGCTCATGAG -3'
(R):5'- ATCTCATGGGACTCTCAGAGGATC -3'
Posted On2020-06-30