Incidental Mutation 'R4198:Olfr1357'
ID318639
Institutional Source Beutler Lab
Gene Symbol Olfr1357
Ensembl Gene ENSMUSG00000071185
Gene Nameolfactory receptor 1357
SynonymsMOR128-4, GA_x6K02T2QGN0-3196801-3197742, MOR128-3
MMRRC Submission 041640-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4198 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location78611003-78618074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78612067 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 191 (D191E)
Ref Sequence ENSEMBL: ENSMUSP00000150167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095473] [ENSMUST00000203305] [ENSMUST00000205085] [ENSMUST00000213877]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095473
AA Change: D191E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000093127
Gene: ENSMUSG00000071185
AA Change: D191E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 215 2e-11 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203305
AA Change: D191E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145032
Gene: ENSMUSG00000071185
AA Change: D191E

DomainStartEndE-ValueType
Pfam:7tm_4 31 235 1.3e-36 PFAM
Pfam:7TM_GPCR_Srsx 35 215 7.7e-11 PFAM
Pfam:7tm_1 41 234 3.4e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205085
AA Change: D191E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000145185
Gene: ENSMUSG00000071185
AA Change: D191E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.7e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 215 2e-11 PFAM
Pfam:7tm_1 41 290 2.6e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213877
AA Change: D191E

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox1 G A 1: 58,085,607 M1002I probably benign Het
Ap2b1 C A 11: 83,342,603 Q481K probably damaging Het
Arhgap31 G A 16: 38,623,913 A194V probably damaging Het
Atp10a A G 7: 58,813,686 D989G probably damaging Het
Ccny G A 18: 9,332,928 T201I probably damaging Het
Cdca5 T C 19: 6,090,352 V181A possibly damaging Het
Ces1g A G 8: 93,305,868 I488T probably benign Het
Csmd2 A G 4: 128,510,924 T2368A probably benign Het
Cux1 T A 5: 136,286,848 I1113F probably damaging Het
Dnah3 C T 7: 119,922,838 G4033D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Foxg1 T A 12: 49,385,299 S272T possibly damaging Het
Fyco1 T C 9: 123,826,634 N1020D probably benign Het
Gprc5c T G 11: 114,863,860 L121R probably damaging Het
Hyou1 G A 9: 44,388,859 R815H probably damaging Het
Kera T C 10: 97,612,973 *352Q probably null Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lnpk T C 2: 74,569,109 E30G probably damaging Het
Map2 C T 1: 66,425,298 R128C probably damaging Het
Olfr1381 G A 11: 49,552,634 V296M possibly damaging Het
Olfr573-ps1 A G 7: 102,941,797 F260S probably damaging Het
Olfr97 T A 17: 37,232,134 M79L probably benign Het
Ror2 A G 13: 53,110,644 M792T probably benign Het
Serpinb9d A G 13: 33,202,674 probably null Het
Serpinb9d A G 13: 33,202,965 I339V probably benign Het
Slc1a1 A G 19: 28,901,452 K197R probably benign Het
Snx20 A G 8: 88,627,598 V168A possibly damaging Het
Sowaha T C 11: 53,478,568 E447G possibly damaging Het
Stard8 AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA X: 99,066,508 probably benign Het
Stx19 G T 16: 62,822,676 C285F possibly damaging Het
Syp A G X: 7,639,927 probably null Het
Tbkbp1 C T 11: 97,149,068 probably null Het
Trim29 G T 9: 43,311,380 E169* probably null Het
Ttll12 T C 15: 83,577,013 N602D probably damaging Het
Zfp26 T C 9: 20,436,716 T851A probably benign Het
Zfp316 T C 5: 143,254,471 M598V probably benign Het
Zhx2 A G 15: 57,821,729 I165V probably benign Het
Other mutations in Olfr1357
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Olfr1357 APN 10 78612126 missense probably benign 0.02
IGL02201:Olfr1357 APN 10 78612270 missense probably damaging 0.96
IGL03029:Olfr1357 APN 10 78611958 missense probably benign 0.14
IGL03094:Olfr1357 APN 10 78612119 missense possibly damaging 0.80
R0207:Olfr1357 UTSW 10 78611871 missense probably benign
R0563:Olfr1357 UTSW 10 78612633 missense probably benign
R0745:Olfr1357 UTSW 10 78612122 missense probably benign 0.02
R1607:Olfr1357 UTSW 10 78612140 missense probably benign 0.08
R2419:Olfr1357 UTSW 10 78612387 missense probably benign 0.34
R4199:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4200:Olfr1357 UTSW 10 78612067 missense possibly damaging 0.69
R4619:Olfr1357 UTSW 10 78612575 missense probably benign
R6152:Olfr1357 UTSW 10 78612575 missense probably benign
R6836:Olfr1357 UTSW 10 78612590 missense probably damaging 1.00
R6843:Olfr1357 UTSW 10 78612057 missense probably damaging 1.00
R7266:Olfr1357 UTSW 10 78612614 missense probably benign 0.07
R8104:Olfr1357 UTSW 10 78612408 missense probably benign 0.29
Z1176:Olfr1357 UTSW 10 78612056 missense probably damaging 1.00
Z1177:Olfr1357 UTSW 10 78612151 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CCAGTAAAGATGGTCCCGTAGAAC -3'
(R):5'- TGATGGCCATTGACAGGCTG -3'

Sequencing Primer
(F):5'- TGGTCCCGTAGAACAGTGACAC -3'
(R):5'- CGCTACTCAGTGCTCATGAG -3'
Posted On2015-06-10