Incidental Mutation 'R8104:Pde6a'
ID630676
Institutional Source Beutler Lab
Gene Symbol Pde6a
Ensembl Gene ENSMUSG00000024575
Gene Namephosphodiesterase 6A, cGMP-specific, rod, alpha
SynonymsPdea
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8104 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location61220482-61289924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61231494 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 207 (D207E)
Ref Sequence ENSEMBL: ENSMUSP00000025468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025468]
Predicted Effect probably damaging
Transcript: ENSMUST00000025468
AA Change: D207E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025468
Gene: ENSMUSG00000024575
AA Change: D207E

DomainStartEndE-ValueType
GAF 73 232 1.36e-21 SMART
GAF 254 441 3.21e-23 SMART
low complexity region 478 495 N/A INTRINSIC
Blast:HDc 496 540 3e-11 BLAST
HDc 556 734 6.95e-8 SMART
Blast:HDc 759 786 1e-8 BLAST
low complexity region 817 837 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.6%
  • 20x: 94.6%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cyclic-GMP (cGMP)-specific phosphodiesterase 6A alpha subunit, expressed in cells of the retinal rod outer segment. The phosphodiesterase 6 holoenzyme is a heterotrimer composed of an alpha, beta, and two gamma subunits. cGMP is an important regulator of rod cell membrane current, and its dynamic concentration is established by phosphodiesterase 6A cGMP hydrolysis and guanylate cyclase cGMP synthesis. The protein is a subunit of a key phototransduction enzyme and participates in processes of transmission and amplification of the visual signal. Mutations in this gene have been identified as one cause of autosomal recessive retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg2 C A 17: 56,845,443 L666F probably benign Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Apoc3 T G 9: 46,233,287 D79A probably damaging Het
Arfgap1 T A 2: 180,979,229 probably null Het
Ascc1 T C 10: 60,007,729 S38P probably benign Het
Asl C T 5: 130,011,950 E389K probably benign Het
Atat1 A T 17: 35,904,116 I215K probably benign Het
BC067074 T A 13: 113,319,729 F770I Het
Bod1l A T 5: 41,833,732 L160* probably null Het
Cbl C A 9: 44,158,539 S637I possibly damaging Het
Ccdc112 A C 18: 46,287,653 S343R probably benign Het
Cr1l A G 1: 195,117,617 S250P possibly damaging Het
Dlgap3 A G 4: 127,236,154 E907G probably damaging Het
Dsp A T 13: 38,168,624 E159D probably benign Het
Ech1 G A 7: 28,825,303 probably benign Het
Erbin G T 13: 103,834,977 N710K possibly damaging Het
Fbxw28 A T 9: 109,326,289 probably null Het
Gm4871 G C 5: 145,032,202 D100E probably damaging Het
Got1l1 A G 8: 27,197,591 I388T probably damaging Het
Ing5 T A 1: 93,816,444 N184K probably damaging Het
Izumo3 A T 4: 92,146,908 L24* probably null Het
Lig1 T C 7: 13,286,565 V99A possibly damaging Het
Mbtps1 A G 8: 119,529,055 Y488H possibly damaging Het
Muc5ac A G 7: 141,804,783 Y1240C possibly damaging Het
Nav3 T C 10: 109,758,967 T1458A probably damaging Het
Nedd1 T C 10: 92,691,916 E472G probably damaging Het
Nod2 A T 8: 88,665,057 H664L possibly damaging Het
Ntrk3 A G 7: 78,577,702 S28P probably damaging Het
Olfr1357 C T 10: 78,612,408 V78I probably benign Het
Olfr298 A G 7: 86,489,023 F176S probably damaging Het
Olfr699 C A 7: 106,791,130 probably benign Het
Olfr699 T A 7: 106,791,131 probably benign Het
Olfr792 T A 10: 129,540,957 M140K probably benign Het
Pcdha4 G T 18: 36,954,053 G430W probably damaging Het
Pcnx T A 12: 81,983,611 Y1114* probably null Het
Plekhg1 T A 10: 3,952,326 I540N Het
Pnp2 A T 14: 50,959,642 I62F probably benign Het
Rarg C A 15: 102,239,899 D258Y probably damaging Het
Rnps1 T A 17: 24,424,510 M262K unknown Het
Scaf11 T C 15: 96,418,602 D1027G probably benign Het
Serpina3a A T 12: 104,112,851 probably benign Het
Slc25a1 A G 16: 17,926,433 probably null Het
Slc44a3 A C 3: 121,497,872 V365G probably benign Het
Slc45a3 T C 1: 131,977,016 F26L probably benign Het
Slc9a2 T A 1: 40,718,649 I116K probably damaging Het
Stk36 T A 1: 74,626,597 S700T probably benign Het
Tekt3 A G 11: 63,078,119 D224G probably benign Het
Tgtp1 A T 11: 48,987,014 I288N probably damaging Het
Ttn C T 2: 76,880,223 V8485M unknown Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Uso1 T A 5: 92,158,421 I79K probably damaging Het
Utp20 C T 10: 88,757,904 D2215N probably damaging Het
Wdr43 C T 17: 71,616,355 A32V probably benign Het
Zfp704 T C 3: 9,565,241 D170G probably benign Het
Other mutations in Pde6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Pde6a APN 18 61257268 missense probably damaging 1.00
IGL00896:Pde6a APN 18 61220792 missense possibly damaging 0.94
IGL01595:Pde6a APN 18 61281528 missense probably damaging 0.98
IGL02971:Pde6a APN 18 61264255 missense probably damaging 1.00
caffeinated UTSW 18 61220606 start codon destroyed probably null 0.95
R0219:Pde6a UTSW 18 61285935 missense possibly damaging 0.57
R0968:Pde6a UTSW 18 61253738 missense probably damaging 0.99
R1304:Pde6a UTSW 18 61258293 missense probably damaging 0.99
R1498:Pde6a UTSW 18 61232860 missense possibly damaging 0.73
R1542:Pde6a UTSW 18 61257045 missense possibly damaging 0.93
R1734:Pde6a UTSW 18 61285965 missense probably damaging 1.00
R1795:Pde6a UTSW 18 61257212 missense probably damaging 1.00
R2173:Pde6a UTSW 18 61254382 missense probably damaging 1.00
R2280:Pde6a UTSW 18 61262434 missense probably damaging 1.00
R2281:Pde6a UTSW 18 61262434 missense probably damaging 1.00
R3617:Pde6a UTSW 18 61231503 splice site probably benign
R4620:Pde6a UTSW 18 61262492 missense probably damaging 1.00
R4727:Pde6a UTSW 18 61231489 missense probably benign 0.02
R4863:Pde6a UTSW 18 61245592 missense probably damaging 1.00
R4904:Pde6a UTSW 18 61265034 missense probably benign 0.08
R4945:Pde6a UTSW 18 61234718 missense probably damaging 1.00
R4953:Pde6a UTSW 18 61231362 nonsense probably null
R5323:Pde6a UTSW 18 61232911 missense possibly damaging 0.81
R5496:Pde6a UTSW 18 61253665 critical splice acceptor site probably null
R5540:Pde6a UTSW 18 61231366 missense probably damaging 0.99
R6180:Pde6a UTSW 18 61284092 splice site probably null
R6366:Pde6a UTSW 18 61265071 splice site probably null
R6743:Pde6a UTSW 18 61263986 missense possibly damaging 0.48
R7161:Pde6a UTSW 18 61281525 missense probably benign 0.05
R7186:Pde6a UTSW 18 61220606 start codon destroyed probably null 0.95
R7197:Pde6a UTSW 18 61258224 missense probably damaging 0.96
R7296:Pde6a UTSW 18 61258293 missense probably damaging 0.99
R7487:Pde6a UTSW 18 61249960 missense probably damaging 1.00
R7734:Pde6a UTSW 18 61232866 missense probably benign 0.10
R7818:Pde6a UTSW 18 61281509 splice site probably null
R8135:Pde6a UTSW 18 61285925 missense probably damaging 0.98
R8213:Pde6a UTSW 18 61220696 missense possibly damaging 0.94
R8266:Pde6a UTSW 18 61258213 missense probably damaging 1.00
R8429:Pde6a UTSW 18 61232844 missense probably damaging 0.98
RF018:Pde6a UTSW 18 61231403 missense possibly damaging 0.84
X0064:Pde6a UTSW 18 61264948 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATACCCCTGTCAGCAGAGTC -3'
(R):5'- GGCTAGCAGGTAAACCCTACAC -3'

Sequencing Primer
(F):5'- AGAGTCTCTGAGATGTTCCCTG -3'
(R):5'- TGAAGCTCATTATGCAGGCC -3'
Posted On2020-06-30