Incidental Mutation 'R8160:4930415F15Rik'
ID633479
Institutional Source Beutler Lab
Gene Symbol 4930415F15Rik
Ensembl Gene ENSMUSG00000020191
Gene Name
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R8160 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11487734 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 246 (S246P)
Ref Sequence ENSEMBL: ENSMUSP00000020410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020410] [ENSMUST00000109678]
Predicted Effect unknown
Transcript: ENSMUST00000020410
AA Change: S246P
SMART Domains Protein: ENSMUSP00000020410
Gene: ENSMUSG00000020191
AA Change: S246P

DomainStartEndE-ValueType
Pfam:DUF4540 90 217 2.5e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109678
SMART Domains Protein: ENSMUSP00000105300
Gene: ENSMUSG00000020191

DomainStartEndE-ValueType
Pfam:DUF4540 17 146 4.6e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 C T 7: 133,968,041 probably null Het
Aldh8a1 A G 10: 21,395,791 D472G possibly damaging Het
Appl1 T C 14: 26,928,635 I527V probably benign Het
Arhgef4 C A 1: 34,723,574 T637K unknown Het
Atp7b G A 8: 21,997,559 A1273V probably damaging Het
Ccl20 T A 1: 83,117,822 S35T Het
Cdh24 C A 14: 54,638,489 V208F probably damaging Het
Dchs2 A T 3: 83,270,805 Q1055L probably benign Het
Dock8 G A 19: 25,147,347 R1009Q probably damaging Het
Ext2 A T 2: 93,813,762 V58E probably benign Het
Fam208a T A 14: 27,449,956 N420K probably damaging Het
Fam209 A T 2: 172,472,725 I45F possibly damaging Het
Hfm1 T C 5: 106,896,033 Y579C probably null Het
Hipk4 C T 7: 27,523,761 A82V possibly damaging Het
Il17rc A G 6: 113,476,528 Y223C possibly damaging Het
Itsn1 G A 16: 91,818,558 R397H unknown Het
Kdm5b T A 1: 134,613,919 M744K probably damaging Het
Mettl16 T C 11: 74,817,679 V568A probably damaging Het
Mink1 C T 11: 70,606,081 Q422* probably null Het
Mvb12b G T 2: 33,840,222 D81E probably benign Het
Nostrin A T 2: 69,179,466 I313F probably damaging Het
Nsun6 A G 2: 15,009,408 probably null Het
Nt5dc1 T A 10: 34,324,396 E209V possibly damaging Het
Oasl2 T C 5: 114,901,286 probably benign Het
Olfr303 C T 7: 86,395,265 V78M possibly damaging Het
Olfr517 C T 7: 108,868,788 R122Q possibly damaging Het
Olfr857 T A 9: 19,712,789 probably benign Het
Ppm1h A T 10: 122,802,436 T204S probably benign Het
Rad51b T A 12: 79,303,341 L70I probably benign Het
Smok3c A G 5: 138,065,024 T258A possibly damaging Het
Snai2 T C 16: 14,706,804 V58A possibly damaging Het
St6galnac1 G A 11: 116,775,490 probably benign Het
Predicted Primers PCR Primer
(F):5'- ACACTTAAAGGGTAACTGTGGG -3'
(R):5'- TGGTGCTCACATTACATGGATC -3'

Sequencing Primer
(F):5'- CTTAAAGGGTAACTGTGGGTGGAG -3'
(R):5'- TAGCCAGCATGGAATCTC -3'
Posted On2020-07-13