Mutagenetix > Incidental Mutation

Incidental Mutation 'R8218:Pik3ca'

636460

Institutional Source

Beutler Lab

Gene Symbol

Pik3ca

Ensembl Gene

ENSMUSG00000027665

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha

Synonyms

caPI3K, 6330412C24Rik, p110alpha

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32397671-32468486 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32437847 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 198 (V198D)

Ref Sequence

ENSEMBL: ENSMUSP00000029201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]

AlphaFold

P42337

PDB Structure

Crystal structure of p110alpha in complex with iSH2 of p85alpha and the inhibitor PIK-108 [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029201
AA Change: V198D

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: V198D

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	3.03e-46	SMART
PI3K_rbd	173	292	5e-47	SMART
PI3K_C2	322	425	2.39e-35	SMART
C2	333	441	3.95e-1	SMART
PI3Ka	518	704	8.35e-99	SMART
Blast:PI3Kc	733	766	1e-11	BLAST
PI3Kc	798	1065	8.82e-130	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108242
AA Change: V76D

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: V76D

Domain	Start	End	E-Value	Type
PI3K_rbd	51	170	5e-47	SMART
PI3K_C2	200	303	2.39e-35	SMART
C2	211	319	3.95e-1	SMART
PI3Ka	396	582	8.35e-99	SMART
Blast:PI3Kc	611	644	1e-11	BLAST
PI3Kc	676	943	8.82e-130	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108243
AA Change: V198D

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: V198D

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	3.03e-46	SMART
PI3K_rbd	173	292	5e-47	SMART
PI3K_C2	322	425	2.39e-35	SMART
C2	333	441	3.95e-1	SMART
PI3Ka	518	704	8.35e-99	SMART
Blast:PI3Kc	733	766	1e-11	BLAST
PI3Kc	798	1065	8.82e-130	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.5%
20x: 98.6%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5031439G07Rik	G	A	15: 84,955,467	H191Y	probably damaging	Het
5730480H06Rik	T	A	5: 48,379,427	L155*	probably null	Het
Ackr4	T	C	9: 104,099,211	N179S	probably benign	Het
Acp5	T	C	9: 22,129,606	Y107C	probably damaging	Het
Aff4	A	T	11: 53,398,257	H411L	probably damaging	Het
Atp5f1	A	G	3: 105,959,186	M1T	probably null	Het
Atp8b5	G	A	4: 43,372,728		probably null	Het
C1qtnf2	A	G	11: 43,490,948	T166A	possibly damaging	Het
Dctn2	A	G	10: 127,276,529	D170G	probably damaging	Het
Dennd3	T	A	15: 73,512,773	S10T	probably benign	Het
Ehbp1	T	C	11: 22,096,096	Y551C	possibly damaging	Het
Eif4g2	A	T	7: 111,074,432	D743E	possibly damaging	Het
Esr1	G	A	10: 4,746,808		probably null	Het
Exo1	A	T	1: 175,900,914	I515L	probably benign	Het
Fam71f2	T	C	6: 29,286,073	I177T	probably damaging	Het
Fam83h	C	T	15: 76,003,037	G817D	probably damaging	Het
Gcn1l1	G	A	5: 115,581,529	S361N	probably benign	Het
Gm6337	C	T	14: 6,050,613		probably null	Het
Grk4	T	A	5: 34,669,196	S47T	probably benign	Het
Gstp2	C	A	19: 4,041,668	M20I	probably benign	Het
Harbi1	T	C	2: 91,712,892	F233L	probably benign	Het
Iqch	C	T	9: 63,482,633	V755I	possibly damaging	Het
Iws1	T	C	18: 32,093,635	F756L	probably benign	Het
Kcnh6	T	G	11: 106,017,374	V272G	possibly damaging	Het
Kcnj10	C	T	1: 172,368,972	R18C	probably damaging	Het
Kmt2c	A	C	5: 25,283,106	S4670A	probably damaging	Het
Krt80	T	G	15: 101,370,003	M18L	probably benign	Het
Lbx1	A	G	19: 45,234,920	V103A	probably benign	Het
March8	A	T	6: 116,338,098		probably benign	Het
Mfsd7c	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Muc16	T	A	9: 18,637,019	T5993S	possibly damaging	Het
Olfr1048	C	T	2: 86,236,518	V106M	probably benign	Het
Olfr1122	C	T	2: 87,388,578	T291I	probably damaging	Het
Olfr346	A	G	2: 36,688,673	T224A	probably benign	Het
Olfr99	A	G	17: 37,279,820	V200A	probably benign	Het
Pbxip1	A	G	3: 89,445,595	I183V	probably benign	Het
Pcdh20	T	A	14: 88,468,611	I418F	probably damaging	Het
Pclo	T	C	5: 14,675,663	F1512L	unknown	Het
Phf2	G	T	13: 48,804,628	T970K	unknown	Het
Pidd1	A	G	7: 141,439,653	V698A	probably damaging	Het
Pip5k1c	T	A	10: 81,306,416	D153E	probably damaging	Het
Ppfia2	A	G	10: 106,863,375	D795G	probably benign	Het
Pramef8	A	T	4: 143,419,136	I392F	probably benign	Het
Prkar2a	C	A	9: 108,719,249	A131D	possibly damaging	Het
Pter	A	G	2: 12,980,555	D232G	probably damaging	Het
Qser1	C	T	2: 104,762,923	R1583Q	probably damaging	Het
Rasal2	A	C	1: 157,157,381	V932G	probably damaging	Het
Rasgrf2	G	A	13: 91,982,677	A154V		Het
Rbm4	A	G	19: 4,787,416	Y347H	probably damaging	Het
Rfxank	C	A	8: 70,131,435		probably null	Het
Robo1	C	G	16: 72,989,790	R897G	possibly damaging	Het
Sash1	G	A	10: 8,751,236	T364I	probably damaging	Het
Skint6	T	A	4: 112,839,274		probably null	Het
Slc22a4	T	A	11: 53,986,581	M495L	probably benign	Het
Slc39a8	G	A	3: 135,857,564	V212I	probably benign	Het
Slc40a1	A	C	1: 45,910,969	V441G	probably benign	Het
Slc7a11	A	T	3: 50,424,052	Y246N	probably damaging	Het
Spata9	T	C	13: 75,977,773	V125A	probably benign	Het
Svopl	T	A	6: 38,014,806	M380L	probably benign	Het
Sycp2l	T	C	13: 41,118,068	Y23H	probably damaging	Het
Syt11	A	T	3: 88,762,120	V155E	probably benign	Het
Syt5	T	C	7: 4,542,823	Y147C	probably damaging	Het
Thg1l	T	C	11: 45,955,450	T6A	probably benign	Het
Tlr2	A	G	3: 83,838,239	L179P	probably damaging	Het
Tsn	A	T	1: 118,305,254	Y107N	probably damaging	Het
Tspan32	A	T	7: 143,011,095	Y114F	probably benign	Het
Tube1	A	C	10: 39,147,379	S341R	possibly damaging	Het
Ubn2	T	A	6: 38,489,279	V516D	probably benign	Het
Vmn1r21	G	T	6: 57,843,925	T178K	noncoding transcript	Het
Vmn2r108	A	G	17: 20,463,203	Y580H	probably damaging	Het
Wdr75	T	A	1: 45,818,182	F546L	probably damaging	Het
Yy1	A	G	12: 108,793,693	D94G	probably benign	Het
Zfhx3	A	G	8: 108,950,717	T2800A	probably benign	Het
Zfy2	T	C	Y: 2,133,421	T9A	unknown	Het

Other mutations in Pik3ca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01284:Pik3ca	APN	3	32462584	missense	probably damaging	1.00
IGL01894:Pik3ca	APN	3	32450026	missense	possibly damaging	0.91
IGL03118:Pik3ca	APN	3	32459935	missense	probably damaging	1.00
IGL03184:Pik3ca	APN	3	32439886	missense	probably benign	0.27
IGL03401:Pik3ca	APN	3	32437814	splice site	probably null
Interrupted	UTSW	3	32438062	missense	probably damaging	1.00
Lilfella	UTSW	3	32454420	missense	probably damaging	1.00
Peninsular	UTSW	3	32462821	missense	probably benign	0.38
Severed	UTSW	3	32437927	missense	possibly damaging	0.65
R0084:Pik3ca	UTSW	3	32462788	missense	possibly damaging	0.78
R0116:Pik3ca	UTSW	3	32459945	missense	probably damaging	1.00
R0278:Pik3ca	UTSW	3	32439753	missense	possibly damaging	0.60
R0513:Pik3ca	UTSW	3	32461511	missense	probably damaging	1.00
R0543:Pik3ca	UTSW	3	32450261	critical splice acceptor site	probably null
R0622:Pik3ca	UTSW	3	32436552	missense	probably damaging	1.00
R0630:Pik3ca	UTSW	3	32450027	missense	possibly damaging	0.91
R1193:Pik3ca	UTSW	3	32456093	missense	probably damaging	0.99
R1292:Pik3ca	UTSW	3	32454420	missense	probably damaging	1.00
R1464:Pik3ca	UTSW	3	32461841	missense	probably damaging	1.00
R1464:Pik3ca	UTSW	3	32461841	missense	probably damaging	1.00
R1869:Pik3ca	UTSW	3	32450350	missense	probably damaging	0.99
R1962:Pik3ca	UTSW	3	32443867	missense	probably benign	0.27
R1969:Pik3ca	UTSW	3	32451754	critical splice acceptor site	probably null
R2006:Pik3ca	UTSW	3	32450057	missense	probably damaging	1.00
R2264:Pik3ca	UTSW	3	32437927	missense	possibly damaging	0.65
R2366:Pik3ca	UTSW	3	32462794	nonsense	probably null
R2680:Pik3ca	UTSW	3	32436548	nonsense	probably null
R2680:Pik3ca	UTSW	3	32443885	missense	probably benign	0.00
R3001:Pik3ca	UTSW	3	32462797	missense	probably damaging	1.00
R3002:Pik3ca	UTSW	3	32462797	missense	probably damaging	1.00
R4303:Pik3ca	UTSW	3	32439935	nonsense	probably null
R4416:Pik3ca	UTSW	3	32461530	missense	probably damaging	0.99
R4758:Pik3ca	UTSW	3	32437978	missense	probably benign	0.20
R4822:Pik3ca	UTSW	3	32437982	missense	probably benign	0.04
R4856:Pik3ca	UTSW	3	32437163	missense	probably damaging	1.00
R4886:Pik3ca	UTSW	3	32437163	missense	probably damaging	1.00
R5297:Pik3ca	UTSW	3	32450053	missense	probably damaging	1.00
R5636:Pik3ca	UTSW	3	32461560	missense	probably damaging	1.00
R5663:Pik3ca	UTSW	3	32462779	missense	probably damaging	1.00
R6249:Pik3ca	UTSW	3	32461563	missense	probably damaging	1.00
R6264:Pik3ca	UTSW	3	32440714	critical splice donor site	probably null
R6347:Pik3ca	UTSW	3	32462821	missense	probably benign	0.38
R6538:Pik3ca	UTSW	3	32439704	missense	probably damaging	1.00
R7020:Pik3ca	UTSW	3	32436279	missense	probably damaging	0.97
R7720:Pik3ca	UTSW	3	32436218	missense	probably damaging	1.00
R7864:Pik3ca	UTSW	3	32443613	nonsense	probably null
R8478:Pik3ca	UTSW	3	32451848	missense	probably benign
R9100:Pik3ca	UTSW	3	32460019	missense	probably damaging	1.00
R9169:Pik3ca	UTSW	3	32449606	critical splice donor site	probably null
R9255:Pik3ca	UTSW	3	32442832	critical splice donor site	probably null
R9267:Pik3ca	UTSW	3	32438062	missense	probably damaging	1.00
R9278:Pik3ca	UTSW	3	32454438	missense	probably damaging	1.00
R9501:Pik3ca	UTSW	3	32449913	missense	probably damaging	1.00
R9555:Pik3ca	UTSW	3	32451767	missense	probably damaging	1.00
Z1177:Pik3ca	UTSW	3	32437967	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAAGGAGCCTTGGATGTTGTG -3'
(R):5'- CTCAGAGGGTACTTTTCCAGG -3'

Sequencing Primer
(F):5'- AGCCTTGGATGTTGTGTCTTTAGAC -3'
(R):5'- TTCCAGGAAGTATTCGTCACAGC -3'

Posted On

2020-07-13