Mutagenetix > Incidental Mutation

Incidental Mutation 'R0622:Pik3ca'

58716

Institutional Source

Beutler Lab

Gene Symbol

Pik3ca

Ensembl Gene

ENSMUSG00000027665

Gene Name

phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha

Synonyms

caPI3K, 6330412C24Rik, p110alpha

MMRRC Submission

038811-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0622 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32397671-32468486 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32436552 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 116 (E116G)

Ref Sequence

ENSEMBL: ENSMUSP00000103878 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]

AlphaFold

P42337

Predicted Effect

probably damaging
Transcript: ENSMUST00000029201
AA Change: E116G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: E116G

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	3.03e-46	SMART
PI3K_rbd	173	292	5e-47	SMART
PI3K_C2	322	425	2.39e-35	SMART
C2	333	441	3.95e-1	SMART
PI3Ka	518	704	8.35e-99	SMART
Blast:PI3Kc	733	766	1e-11	BLAST
PI3Kc	798	1065	8.82e-130	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108242

SMART Domains

Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665

Domain	Start	End	E-Value	Type
PI3K_rbd	51	170	5e-47	SMART
PI3K_C2	200	303	2.39e-35	SMART
C2	211	319	3.95e-1	SMART
PI3Ka	396	582	8.35e-99	SMART
Blast:PI3Kc	611	644	1e-11	BLAST
PI3Kc	676	943	8.82e-130	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108243
AA Change: E116G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: E116G

Domain	Start	End	E-Value	Type
PI3K_p85B	31	108	3.03e-46	SMART
PI3K_rbd	173	292	5e-47	SMART
PI3K_C2	322	425	2.39e-35	SMART
C2	333	441	3.95e-1	SMART
PI3Ka	518	704	8.35e-99	SMART
Blast:PI3Kc	733	766	1e-11	BLAST
PI3Kc	798	1065	8.82e-130	SMART

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agtr1a	T	A	13: 30,381,681	M243K	probably benign	Het
Ap1b1	A	G	11: 5,037,707	M744V	probably damaging	Het
C87977	T	C	4: 144,213,013		probably benign	Het
Ccdc152	T	C	15: 3,298,178	N39S	probably damaging	Het
Cd163	G	A	6: 124,317,352	V490M	probably damaging	Het
Col6a5	G	T	9: 105,925,852	H1305N	unknown	Het
Cpb1	C	A	3: 20,249,818	D361Y	probably damaging	Het
Dchs1	T	A	7: 105,763,449	Y1248F	probably damaging	Het
Dhdds	G	C	4: 133,994,236	F83L	probably damaging	Het
Dsg4	T	A	18: 20,449,788	V161E	possibly damaging	Het
Exosc4	A	G	15: 76,327,536	D15G	probably damaging	Het
F3	A	T	3: 121,725,019	D44V	probably damaging	Het
Fat2	A	T	11: 55,283,128	F2253Y	probably damaging	Het
Fbn1	T	C	2: 125,379,024	D650G	possibly damaging	Het
Gramd4	T	A	15: 86,091,389	F36I	probably damaging	Het
Grm7	G	A	6: 111,358,496	A623T	probably damaging	Het
Gys1	A	T	7: 45,439,995	T193S	probably damaging	Het
Hectd4	A	G	5: 121,348,625	T3228A	possibly damaging	Het
Itpk1	G	T	12: 102,573,980	D281E	probably damaging	Het
Kcnh7	A	C	2: 62,837,289		probably null	Het
Klhl29	A	G	12: 5,081,224	L852P	probably damaging	Het
Lrch1	T	C	14: 74,796,051	Y509C	probably benign	Het
Lrp1b	A	G	2: 41,728,551		probably null	Het
Mcpt4	C	A	14: 56,060,662	R144L	probably benign	Het
Mia2	C	T	12: 59,131,578	R12W	probably damaging	Het
Mrps5	A	G	2: 127,594,531	K116R	probably benign	Het
Myrf	G	A	19: 10,223,452	P286S	probably damaging	Het
Nanp	A	G	2: 151,039,244	M28T	probably benign	Het
Neb	T	C	2: 52,212,951	I4472V	probably benign	Het
Nfix	A	C	8: 84,726,482	N314K	probably damaging	Het
Nlrc3	C	T	16: 3,953,968	R849Q	probably benign	Het
Nup210l	G	A	3: 90,167,740	V786M	probably damaging	Het
Olfr1346	T	C	7: 6,474,599	I163T	possibly damaging	Het
Olfr314	T	C	11: 58,786,341	S36P	probably damaging	Het
Olfr600	A	G	7: 103,346,857	S24P	probably damaging	Het
Olfr898	A	G	9: 38,349,371	N96S	possibly damaging	Het
Pdia4	A	T	6: 47,806,518	F197Y	probably damaging	Het
Phldb1	T	C	9: 44,715,852	D432G	probably damaging	Het
Polq	T	C	16: 37,060,993	V1173A	probably benign	Het
Pou2f3	C	T	9: 43,125,119	R423H	probably damaging	Het
Prkag2	T	C	5: 24,869,249	N246S	probably damaging	Het
Proser1	A	G	3: 53,477,860	S388G	probably benign	Het
Ralgps1	G	A	2: 33,174,447	R238*	probably null	Het
Rfx2	T	C	17: 56,777,071	D657G	probably damaging	Het
Ryr3	A	G	2: 112,662,555	F3724S	probably damaging	Het
Sh2d5	T	C	4: 138,259,228	S421P	probably damaging	Het
Slc17a2	C	A	13: 23,812,611	T33K	probably damaging	Het
St8sia5	A	G	18: 77,246,113	T156A	probably damaging	Het
Stk32c	T	C	7: 139,188,110	D85G	probably benign	Het
Tnks	A	G	8: 34,940,822	S251P	probably damaging	Het
Tnxb	T	A	17: 34,718,729	L3864Q	probably damaging	Het
Trim9	A	G	12: 70,346,604	Y189H	probably damaging	Het
Vmn1r77	T	G	7: 12,041,388	F30L	probably benign	Het
Wasf3	A	G	5: 146,466,792		probably null	Het
Wdr90	C	T	17: 25,855,658	C603Y	probably damaging	Het
Zdhhc25	T	C	15: 88,601,107	L215P	probably damaging	Het
Zeb1	C	T	18: 5,759,123	Q140*	probably null	Het
Zfp677	C	T	17: 21,397,700	L340F	probably benign	Het

Other mutations in Pik3ca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01284:Pik3ca	APN	3	32462584	missense	probably damaging	1.00
IGL01894:Pik3ca	APN	3	32450026	missense	possibly damaging	0.91
IGL03118:Pik3ca	APN	3	32459935	missense	probably damaging	1.00
IGL03184:Pik3ca	APN	3	32439886	missense	probably benign	0.27
IGL03401:Pik3ca	APN	3	32437814	splice site	probably null
Interrupted	UTSW	3	32438062	missense	probably damaging	1.00
Lilfella	UTSW	3	32454420	missense	probably damaging	1.00
Peninsular	UTSW	3	32462821	missense	probably benign	0.38
Severed	UTSW	3	32437927	missense	possibly damaging	0.65
R0084:Pik3ca	UTSW	3	32462788	missense	possibly damaging	0.78
R0116:Pik3ca	UTSW	3	32459945	missense	probably damaging	1.00
R0278:Pik3ca	UTSW	3	32439753	missense	possibly damaging	0.60
R0513:Pik3ca	UTSW	3	32461511	missense	probably damaging	1.00
R0543:Pik3ca	UTSW	3	32450261	critical splice acceptor site	probably null
R0630:Pik3ca	UTSW	3	32450027	missense	possibly damaging	0.91
R1193:Pik3ca	UTSW	3	32456093	missense	probably damaging	0.99
R1292:Pik3ca	UTSW	3	32454420	missense	probably damaging	1.00
R1464:Pik3ca	UTSW	3	32461841	missense	probably damaging	1.00
R1464:Pik3ca	UTSW	3	32461841	missense	probably damaging	1.00
R1869:Pik3ca	UTSW	3	32450350	missense	probably damaging	0.99
R1962:Pik3ca	UTSW	3	32443867	missense	probably benign	0.27
R1969:Pik3ca	UTSW	3	32451754	critical splice acceptor site	probably null
R2006:Pik3ca	UTSW	3	32450057	missense	probably damaging	1.00
R2264:Pik3ca	UTSW	3	32437927	missense	possibly damaging	0.65
R2366:Pik3ca	UTSW	3	32462794	nonsense	probably null
R2680:Pik3ca	UTSW	3	32436548	nonsense	probably null
R2680:Pik3ca	UTSW	3	32443885	missense	probably benign	0.00
R3001:Pik3ca	UTSW	3	32462797	missense	probably damaging	1.00
R3002:Pik3ca	UTSW	3	32462797	missense	probably damaging	1.00
R4303:Pik3ca	UTSW	3	32439935	nonsense	probably null
R4416:Pik3ca	UTSW	3	32461530	missense	probably damaging	0.99
R4758:Pik3ca	UTSW	3	32437978	missense	probably benign	0.20
R4822:Pik3ca	UTSW	3	32437982	missense	probably benign	0.04
R4856:Pik3ca	UTSW	3	32437163	missense	probably damaging	1.00
R4886:Pik3ca	UTSW	3	32437163	missense	probably damaging	1.00
R5297:Pik3ca	UTSW	3	32450053	missense	probably damaging	1.00
R5636:Pik3ca	UTSW	3	32461560	missense	probably damaging	1.00
R5663:Pik3ca	UTSW	3	32462779	missense	probably damaging	1.00
R6249:Pik3ca	UTSW	3	32461563	missense	probably damaging	1.00
R6264:Pik3ca	UTSW	3	32440714	critical splice donor site	probably null
R6347:Pik3ca	UTSW	3	32462821	missense	probably benign	0.38
R6538:Pik3ca	UTSW	3	32439704	missense	probably damaging	1.00
R7020:Pik3ca	UTSW	3	32436279	missense	probably damaging	0.97
R7720:Pik3ca	UTSW	3	32436218	missense	probably damaging	1.00
R7864:Pik3ca	UTSW	3	32443613	nonsense	probably null
R8218:Pik3ca	UTSW	3	32437847	missense	possibly damaging	0.74
R8478:Pik3ca	UTSW	3	32451848	missense	probably benign
R9100:Pik3ca	UTSW	3	32460019	missense	probably damaging	1.00
R9169:Pik3ca	UTSW	3	32449606	critical splice donor site	probably null
R9255:Pik3ca	UTSW	3	32442832	critical splice donor site	probably null
R9267:Pik3ca	UTSW	3	32438062	missense	probably damaging	1.00
R9278:Pik3ca	UTSW	3	32454438	missense	probably damaging	1.00
R9501:Pik3ca	UTSW	3	32449913	missense	probably damaging	1.00
R9555:Pik3ca	UTSW	3	32451767	missense	probably damaging	1.00
Z1177:Pik3ca	UTSW	3	32437967	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGGCCAGGAAATACCCTCTCCAT -3'
(R):5'- ACCCTACAGGATATCAAAGCGTTACGA -3'

Sequencing Primer
(F):5'- TCCATCAGCTTCTGCAAGACG -3'
(R):5'- GCGTTACGAAGTTCTATAGCTCAG -3'

Posted On

2013-07-11