Incidental Mutation 'R8233:Magoh'
ID637218
Institutional Source Beutler Lab
Gene Symbol Magoh
Ensembl Gene ENSMUSG00000028609
Gene Namemago homolog, exon junction complex core component
SynonymsMos2, Mago-m
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location107879755-107887424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107880935 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 44 (V44G)
Ref Sequence ENSEMBL: ENSMUSP00000030348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030348]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030348
AA Change: V44G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030348
Gene: ENSMUSG00000028609
AA Change: V44G

DomainStartEndE-ValueType
Pfam:Mago_nashi 5 146 7.5e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106731
SMART Domains Protein: ENSMUSP00000102342
Gene: ENSMUSG00000028613

DomainStartEndE-ValueType
EGF_like 9 47 3.29e1 SMART
LDLa 9 48 2.45e-13 SMART
LDLa 50 89 1.19e-11 SMART
LDLa 93 130 4.58e-13 SMART
EGF 134 170 2.83e-5 SMART
EGF_CA 171 210 9.91e-10 SMART
LY 237 279 8.44e-4 SMART
LY 284 326 2.29e-14 SMART
LY 327 370 5.96e-13 SMART
LY 371 413 4.21e-13 SMART
LY 415 457 7.24e-3 SMART
EGF 484 530 1.56e1 SMART
low complexity region 532 548 N/A INTRINSIC
low complexity region 586 601 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 666 672 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Drosophila that have mutations in their mago nashi (grandchildless) gene produce progeny with defects in germplasm assembly and germline development. This gene encodes the mammalian mago nashi homolog. In mammals, mRNA expression is not limited to the germ plasm, but is expressed ubiquitously in adult tissues and can be induced by serum stimulation of quiescent fibroblasts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation in this gene is embryonic lethal and heterozygous mice are postnatal lethal with incomplete penetrance with reduced body size and microcephaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Magoh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Magoh APN 4 107885006 unclassified probably benign
IGL01777:Magoh APN 4 107883176 missense probably benign 0.01
R0508:Magoh UTSW 4 107884998 missense possibly damaging 0.79
R1164:Magoh UTSW 4 107887262 missense probably benign 0.37
R1694:Magoh UTSW 4 107883165 missense probably benign 0.09
R3116:Magoh UTSW 4 107887212 missense possibly damaging 0.94
R7609:Magoh UTSW 4 107887212 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGACTCTAGTTTACTGTCAGGTCC -3'
(R):5'- AGCTTTTGATTCAGCACTGGG -3'

Sequencing Primer
(F):5'- CACTACTATCACAGCTGGGAAATGG -3'
(R):5'- AAGTGCTCGCTTCCTACA -3'
Posted On2020-07-13