Incidental Mutation 'R8233:Stmn4'
ID637233
Institutional Source Beutler Lab
Gene Symbol Stmn4
Ensembl Gene ENSMUSG00000022044
Gene Namestathmin-like 4
SynonymsRB3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location66344296-66361680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66357892 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 122 (H122R)
Ref Sequence ENSEMBL: ENSMUSP00000074113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074523] [ENSMUST00000118426] [ENSMUST00000120229] [ENSMUST00000121955] [ENSMUST00000134440] [ENSMUST00000152093]
Predicted Effect probably damaging
Transcript: ENSMUST00000074523
AA Change: H122R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000074113
Gene: ENSMUSG00000022044
AA Change: H122R

DomainStartEndE-ValueType
Pfam:Stathmin 48 187 1.6e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118426
AA Change: H122R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113629
Gene: ENSMUSG00000022044
AA Change: H122R

DomainStartEndE-ValueType
Pfam:Stathmin 48 176 3.9e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120229
AA Change: H149R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113759
Gene: ENSMUSG00000022044
AA Change: H149R

DomainStartEndE-ValueType
Pfam:Stathmin 78 211 3.5e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121955
AA Change: H149R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113788
Gene: ENSMUSG00000022044
AA Change: H149R

DomainStartEndE-ValueType
Pfam:Stathmin 75 203 1.2e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134440
Predicted Effect probably benign
Transcript: ENSMUST00000152093
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Stmn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0271:Stmn4 UTSW 14 66356283 nonsense probably null
R0541:Stmn4 UTSW 14 66357939 missense probably benign 0.15
R1118:Stmn4 UTSW 14 66354395 utr 5 prime probably benign
R1902:Stmn4 UTSW 14 66355609 missense probably damaging 1.00
R4117:Stmn4 UTSW 14 66361132 makesense probably null
R4276:Stmn4 UTSW 14 66355717 intron probably benign
R5430:Stmn4 UTSW 14 66358014 missense possibly damaging 0.92
R5804:Stmn4 UTSW 14 66356299 missense probably benign
R7552:Stmn4 UTSW 14 66356278 missense probably damaging 1.00
R7879:Stmn4 UTSW 14 66357939 missense probably benign 0.01
R8007:Stmn4 UTSW 14 66355583 splice site probably benign
Predicted Primers PCR Primer
(F):5'- GCTCTCTGCTTCTGTGAAAGAG -3'
(R):5'- TCCATTCCTGCAGAGGCTAC -3'

Sequencing Primer
(F):5'- CTTCTGTGAAAGAGGACCAGGTTC -3'
(R):5'- AGAGGCTACTTCCACCAGAGTG -3'
Posted On2020-07-13