Incidental Mutation 'R8233:Polr2m'
ID637227
Institutional Source Beutler Lab
Gene Symbol Polr2m
Ensembl Gene ENSMUSG00000032199
Gene Namepolymerase (RNA) II (DNA directed) polypeptide M
SynonymsD9Wsu138e, Grinl1a
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location71478437-71485935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71483584 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 112 (D112V)
Ref Sequence ENSEMBL: ENSMUSP00000034720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034720] [ENSMUST00000163972] [ENSMUST00000163998] [ENSMUST00000164962] [ENSMUST00000165936] [ENSMUST00000166843] [ENSMUST00000169804]
Predicted Effect probably benign
Transcript: ENSMUST00000034720
AA Change: D112V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034720
Gene: ENSMUSG00000032199
AA Change: D112V

DomainStartEndE-ValueType
Pfam:GCOM2 28 239 2.1e-79 PFAM
coiled coil region 299 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163972
AA Change: D8V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132335
Gene: ENSMUSG00000032199
AA Change: D8V

DomainStartEndE-ValueType
Pfam:GCOM2 1 142 1.6e-27 PFAM
coiled coil region 195 224 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163998
SMART Domains Protein: ENSMUSP00000131267
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
coiled coil region 105 138 N/A INTRINSIC
coiled coil region 187 415 N/A INTRINSIC
coiled coil region 483 512 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164962
SMART Domains Protein: ENSMUSP00000131353
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
Pfam:GCOM2 96 390 7.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165936
SMART Domains Protein: ENSMUSP00000127356
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
Pfam:GCOM2 96 379 4.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166843
SMART Domains Protein: ENSMUSP00000128698
Gene: ENSMUSG00000092137

DomainStartEndE-ValueType
Pfam:GCOM2 96 416 4.6e-67 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000169804
AA Change: E38D
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a specific form of RNA polymerase II termed Pol II(G). The encoded protein may act as a negative regulator of transcriptional activation by the Mediator complex. Alternative splicing results in multiple transcript variants. There is a pseudogene for this gene on chromosome 4. Readthrough transcription between this gene and the neighboring upstream gene MYZAP (myocardial zonula adherens protein) is represented with GeneID 145781. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Polr2m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02810:Polr2m APN 9 71483566 missense probably benign 0.42
IGL02956:Polr2m APN 9 71483629 missense possibly damaging 0.88
R1604:Polr2m UTSW 9 71483677 missense probably damaging 1.00
R4828:Polr2m UTSW 9 71483768 missense possibly damaging 0.65
R5748:Polr2m UTSW 9 71483636 missense probably benign 0.02
R5990:Polr2m UTSW 9 71479320 splice site probably null
R6042:Polr2m UTSW 9 71483798 missense probably damaging 0.98
R6476:Polr2m UTSW 9 71483470 missense probably benign 0.02
R6579:Polr2m UTSW 9 71485720 missense probably damaging 1.00
R7150:Polr2m UTSW 9 71483344 missense probably damaging 1.00
R7150:Polr2m UTSW 9 71483533 missense probably benign 0.00
R7631:Polr2m UTSW 9 71483475 nonsense probably null
R8203:Polr2m UTSW 9 71479486 missense probably benign 0.07
X0067:Polr2m UTSW 9 71479460 missense probably damaging 0.98
Predicted Primers
Posted On2020-07-13