Incidental Mutation 'R8314:Ak4'
ID641554
Institutional Source Beutler Lab
Gene Symbol Ak4
Ensembl Gene ENSMUSG00000028527
Gene Nameadenylate kinase 4
SynonymsAk-3, Ak3l1, Ak4, Ak-4, D4Ertd274e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R8314 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location101419277-101466995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101463585 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 197 (T197M)
Ref Sequence ENSEMBL: ENSMUSP00000102558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102780] [ENSMUST00000106945] [ENSMUST00000106946] [ENSMUST00000131397] [ENSMUST00000133055]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102780
AA Change: T197M

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099841
Gene: ENSMUSG00000028527
AA Change: T197M

DomainStartEndE-ValueType
Pfam:AAA_17 7 193 3.2e-12 PFAM
Pfam:AAA_18 9 133 8.7e-11 PFAM
Pfam:ADK 10 190 2e-50 PFAM
Pfam:ADK_lid 126 161 3.3e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106945
AA Change: T197M

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102558
Gene: ENSMUSG00000028527
AA Change: T197M

DomainStartEndE-ValueType
Pfam:AAA_17 7 193 3.2e-12 PFAM
Pfam:AAA_18 9 133 8.7e-11 PFAM
Pfam:ADK 10 190 2e-50 PFAM
Pfam:ADK_lid 126 161 3.3e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106946
AA Change: T197M

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102559
Gene: ENSMUSG00000028527
AA Change: T197M

DomainStartEndE-ValueType
Pfam:AAA_17 7 179 1.1e-7 PFAM
Pfam:Cytidylate_kin 8 55 3.5e-7 PFAM
Pfam:AAA_18 9 134 4.5e-11 PFAM
Pfam:ADK 10 190 1.8e-50 PFAM
Pfam:ADK_lid 126 161 1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131397
SMART Domains Protein: ENSMUSP00000115456
Gene: ENSMUSG00000028527

DomainStartEndE-ValueType
Pfam:AAA_17 7 115 1.1e-11 PFAM
Pfam:AAA_18 9 115 3.6e-8 PFAM
Pfam:ADK 10 115 1.7e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133055
SMART Domains Protein: ENSMUSP00000115454
Gene: ENSMUSG00000028527

DomainStartEndE-ValueType
Pfam:AAA_17 7 111 2.2e-10 PFAM
Pfam:ADK 10 48 2.9e-16 PFAM
Pfam:ADK 47 122 5.8e-9 PFAM
Pfam:ADK_lid 86 121 1.1e-18 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121112
Gene: ENSMUSG00000028527
AA Change: T114M

DomainStartEndE-ValueType
Pfam:ADK 1 108 2.1e-20 PFAM
Pfam:ADK_lid 57 82 9.3e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylate kinase family of enzymes. The encoded protein is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. A pseudogene for this gene has been located on chromosome 17. Three transcript variants encoding the same protein have been identified for this gene. Sequence alignment suggests that the gene defined by NM_013410, NM_203464, and NM_001005353 is located on chromosome 1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,928 T84S probably benign Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930533K18Rik A G 10: 70,875,276 T76A noncoding transcript Het
Adgrl1 C T 8: 83,938,389 T1235I probably damaging Het
Alox12e T C 11: 70,316,172 M603V possibly damaging Het
Ap3d1 A T 10: 80,723,539 I267N possibly damaging Het
Arhgef2 T A 3: 88,621,293 I12N probably benign Het
Asnsd1 A T 1: 53,346,655 M520K probably damaging Het
B3galt5 T C 16: 96,315,449 L94P probably damaging Het
Birc3 T C 9: 7,872,941 probably benign Het
Cd177 T C 7: 24,750,588 S541G probably benign Het
Cdh8 T C 8: 99,171,379 D434G probably damaging Het
Cdkn3 A T 14: 46,769,873 silent Het
Ciita A T 16: 10,510,988 R379W probably damaging Het
Cntrl T A 2: 35,175,143 M2153K probably benign Het
Csmd1 A T 8: 16,158,244 D1232E probably benign Het
Cyp4a30b A C 4: 115,458,338 H252P probably benign Het
Dad1 G A 14: 54,253,812 R11W probably damaging Het
Ddit3 A G 10: 127,295,721 probably null Het
Dusp22 G A 13: 30,708,931 probably benign Het
Dzank1 A G 2: 144,502,958 L293P probably damaging Het
Edf1 A G 2: 25,557,965 D5G probably damaging Het
Ep400 T A 5: 110,755,753 M327L unknown Het
Fam135a A T 1: 24,021,921 H1341Q possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam189b T C 3: 89,188,146 probably null Het
Fbxl3 C T 14: 103,089,440 V169I probably benign Het
Gm4787 A G 12: 81,379,135 L83P probably damaging Het
Habp4 A G 13: 64,184,751 E392G probably damaging Het
Hspg2 C A 4: 137,539,675 P1997Q probably benign Het
Ints9 T C 14: 65,029,030 S444P probably damaging Het
Kif18b G A 11: 102,913,074 S420L probably benign Het
Klhl17 T A 4: 156,234,013 M51L probably benign Het
Kmt2b C T 7: 30,578,922 E1555K probably damaging Het
Malrd1 T A 2: 15,752,832 D972E unknown Het
Mapk8ip3 A T 17: 24,901,774 S805R probably benign Het
Mmp13 G A 9: 7,272,931 C97Y probably damaging Het
Moxd1 T A 10: 24,252,540 N163K possibly damaging Het
Nbea T C 3: 56,009,251 I863V probably damaging Het
Nectin4 A G 1: 171,384,727 T298A probably benign Het
Net1 T C 13: 3,912,672 probably benign Het
Ntn1 T C 11: 68,385,624 D166G probably damaging Het
Olfr1137 A G 2: 87,711,202 F235L probably benign Het
Olfr140 T C 2: 90,052,097 T76A probably benign Het
Olfr391-ps T G 11: 73,799,742 N5T noncoding transcript Het
Olfr620 T C 7: 103,612,047 Q102R probably damaging Het
Olfr948 A G 9: 39,319,305 F103S probably damaging Het
Opa3 C A 7: 19,245,015 A135E possibly damaging Het
Osbpl5 T C 7: 143,695,096 I608V probably benign Het
Phc1 A C 6: 122,320,978 S782R unknown Het
Pip5k1b T A 19: 24,355,199 T374S probably benign Het
Prkaa1 A G 15: 5,178,873 S541G probably damaging Het
Ptpn20 A G 14: 33,622,547 N143D possibly damaging Het
Rabep1 A G 11: 70,893,660 D207G possibly damaging Het
Rbbp8 G A 18: 11,720,625 M296I probably benign Het
Recql4 C A 15: 76,710,180 R46L probably damaging Het
Scgb2b18 T C 7: 33,173,157 I74M probably benign Het
Shc4 A G 2: 125,655,616 I391T possibly damaging Het
Slc38a4 A G 15: 97,010,309 F184L probably benign Het
Slc7a6 A G 8: 106,168,958 probably benign Het
Smim13 G T 13: 41,272,634 G49* probably null Het
Tbc1d19 A G 5: 53,897,047 D459G probably damaging Het
Tnpo1 T C 13: 98,884,625 N82S possibly damaging Het
Tpp2 G A 1: 43,934,227 V47I probably benign Het
Umodl1 G T 17: 30,984,832 A540S probably damaging Het
Vmn2r83 G A 10: 79,481,479 V519I possibly damaging Het
Zfp641 T C 15: 98,290,583 I139V probably damaging Het
Zfyve21 A T 12: 111,823,281 I60F probably benign Het
Other mutations in Ak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Ak4 APN 4 101447189 nonsense probably null
IGL03077:Ak4 APN 4 101419951 missense probably damaging 0.98
R1903:Ak4 UTSW 4 101463636 missense possibly damaging 0.47
R5423:Ak4 UTSW 4 101460563 missense probably damaging 1.00
R6309:Ak4 UTSW 4 101463662 missense probably benign
R6936:Ak4 UTSW 4 101447259 missense probably benign 0.00
R7571:Ak4 UTSW 4 101460542 missense probably benign 0.32
R8057:Ak4 UTSW 4 101460653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACAGCTCCAGACCCTTG -3'
(R):5'- TATCTCAGCTGGCTTCTAACTGGG -3'

Sequencing Primer
(F):5'- AGACCCTTGTTTTCCTATTTAATCGG -3'
(R):5'- TTCTAACTGGGCCAGGTCAC -3'
Posted On2020-07-28