Incidental Mutation 'R8314:Tnpo1'
ID641589
Institutional Source Beutler Lab
Gene Symbol Tnpo1
Ensembl Gene ENSMUSG00000009470
Gene Nametransportin 1
SynonymsKpnb2, D13Ertd688e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R8314 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location98839019-98926384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98884625 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 82 (N82S)
Ref Sequence ENSEMBL: ENSMUSP00000105028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109399] [ENSMUST00000109401] [ENSMUST00000179271] [ENSMUST00000179301]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109399
AA Change: N74S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105026
Gene: ENSMUSG00000009470
AA Change: N74S

DomainStartEndE-ValueType
IBN_N 33 101 1.53e-6 SMART
low complexity region 350 368 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
Pfam:HEAT_EZ 411 465 4.7e-12 PFAM
Pfam:HEAT 439 469 6.8e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109401
AA Change: N82S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105028
Gene: ENSMUSG00000009470
AA Change: N82S

DomainStartEndE-ValueType
IBN_N 41 109 1.53e-6 SMART
low complexity region 358 376 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
Pfam:HEAT_EZ 419 473 6.6e-15 PFAM
Pfam:HEAT 447 477 1.3e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179271
AA Change: N74S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136496
Gene: ENSMUSG00000009470
AA Change: N74S

DomainStartEndE-ValueType
IBN_N 33 101 1.53e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179301
AA Change: N74S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136917
Gene: ENSMUSG00000009470
AA Change: N74S

DomainStartEndE-ValueType
IBN_N 33 101 1.53e-6 SMART
low complexity region 350 368 N/A INTRINSIC
low complexity region 393 410 N/A INTRINSIC
Pfam:HEAT_EZ 411 465 4.2e-12 PFAM
Pfam:HEAT 439 469 6.1e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the karyopherin receptor complex which interacts with nuclear localization signals to target nuclear proteins to the nucleus. The karyopherin receptor complex is a heterodimer of an alpha subunit which recognizes the nuclear localization signal and a beta subunit which docks the complex at nucleoporins. Alternate splicing of this gene results in two transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059G10Rik T A 9: 122,948,928 T84S probably benign Het
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
4930533K18Rik A G 10: 70,875,276 T76A noncoding transcript Het
Adgrl1 C T 8: 83,938,389 T1235I probably damaging Het
Ak4 C T 4: 101,463,585 T197M possibly damaging Het
Alox12e T C 11: 70,316,172 M603V possibly damaging Het
Ap3d1 A T 10: 80,723,539 I267N possibly damaging Het
Arhgef2 T A 3: 88,621,293 I12N probably benign Het
Asnsd1 A T 1: 53,346,655 M520K probably damaging Het
B3galt5 T C 16: 96,315,449 L94P probably damaging Het
Birc3 T C 9: 7,872,941 probably benign Het
Cd177 T C 7: 24,750,588 S541G probably benign Het
Cdh8 T C 8: 99,171,379 D434G probably damaging Het
Ciita A T 16: 10,510,988 R379W probably damaging Het
Cntrl T A 2: 35,175,143 M2153K probably benign Het
Csmd1 A T 8: 16,158,244 D1232E probably benign Het
Cyp4a30b A C 4: 115,458,338 H252P probably benign Het
Dad1 G A 14: 54,253,812 R11W probably damaging Het
Ddit3 A G 10: 127,295,721 probably null Het
Dzank1 A G 2: 144,502,958 L293P probably damaging Het
Edf1 A G 2: 25,557,965 D5G probably damaging Het
Ep400 T A 5: 110,755,753 M327L unknown Het
Fam135a A T 1: 24,021,921 H1341Q possibly damaging Het
Fam150b G T 12: 30,884,851 G23V probably damaging Het
Fam189b T C 3: 89,188,146 probably null Het
Fbxl3 C T 14: 103,089,440 V169I probably benign Het
Gm4787 A G 12: 81,379,135 L83P probably damaging Het
Habp4 A G 13: 64,184,751 E392G probably damaging Het
Hspg2 C A 4: 137,539,675 P1997Q probably benign Het
Ints9 T C 14: 65,029,030 S444P probably damaging Het
Kif18b G A 11: 102,913,074 S420L probably benign Het
Klhl17 T A 4: 156,234,013 M51L probably benign Het
Kmt2b C T 7: 30,578,922 E1555K probably damaging Het
Malrd1 T A 2: 15,752,832 D972E unknown Het
Mapk8ip3 A T 17: 24,901,774 S805R probably benign Het
Mmp13 G A 9: 7,272,931 C97Y probably damaging Het
Moxd1 T A 10: 24,252,540 N163K possibly damaging Het
Nbea T C 3: 56,009,251 I863V probably damaging Het
Nectin4 A G 1: 171,384,727 T298A probably benign Het
Ntn1 T C 11: 68,385,624 D166G probably damaging Het
Olfr1137 A G 2: 87,711,202 F235L probably benign Het
Olfr140 T C 2: 90,052,097 T76A probably benign Het
Olfr391-ps T G 11: 73,799,742 N5T noncoding transcript Het
Olfr620 T C 7: 103,612,047 Q102R probably damaging Het
Olfr948 A G 9: 39,319,305 F103S probably damaging Het
Opa3 C A 7: 19,245,015 A135E possibly damaging Het
Osbpl5 T C 7: 143,695,096 I608V probably benign Het
Phc1 A C 6: 122,320,978 S782R unknown Het
Pip5k1b T A 19: 24,355,199 T374S probably benign Het
Prkaa1 A G 15: 5,178,873 S541G probably damaging Het
Ptpn20 A G 14: 33,622,547 N143D possibly damaging Het
Rabep1 A G 11: 70,893,660 D207G possibly damaging Het
Rbbp8 G A 18: 11,720,625 M296I probably benign Het
Recql4 C A 15: 76,710,180 R46L probably damaging Het
Scgb2b18 T C 7: 33,173,157 I74M probably benign Het
Shc4 A G 2: 125,655,616 I391T possibly damaging Het
Slc38a4 A G 15: 97,010,309 F184L probably benign Het
Smim13 G T 13: 41,272,634 G49* probably null Het
Tbc1d19 A G 5: 53,897,047 D459G probably damaging Het
Tpp2 G A 1: 43,934,227 V47I probably benign Het
Umodl1 G T 17: 30,984,832 A540S probably damaging Het
Vmn2r83 G A 10: 79,481,479 V519I possibly damaging Het
Zfp641 T C 15: 98,290,583 I139V probably damaging Het
Zfyve21 A T 12: 111,823,281 I60F probably benign Het
Other mutations in Tnpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Tnpo1 APN 13 98850104 splice site probably benign
IGL02572:Tnpo1 APN 13 98849159 missense probably damaging 1.00
IGL03040:Tnpo1 APN 13 98859955 missense probably damaging 0.99
IGL03237:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03379:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03393:Tnpo1 APN 13 98888473 missense probably damaging 0.99
IGL03405:Tnpo1 APN 13 98863840 missense probably damaging 0.98
IGL03407:Tnpo1 APN 13 98863840 missense probably damaging 0.98
Domineight UTSW 13 98867129 frame shift probably null
invert UTSW 13 98855446 missense probably damaging 1.00
R0308:Tnpo1 UTSW 13 98846503 missense probably damaging 0.97
R0465:Tnpo1 UTSW 13 98884634 missense probably damaging 0.97
R0492:Tnpo1 UTSW 13 98855446 missense probably damaging 1.00
R0707:Tnpo1 UTSW 13 98855446 missense probably damaging 1.00
R0732:Tnpo1 UTSW 13 98863812 missense probably damaging 0.99
R1314:Tnpo1 UTSW 13 98860722 missense probably damaging 0.99
R1449:Tnpo1 UTSW 13 98878712 missense probably damaging 0.99
R1468:Tnpo1 UTSW 13 98850157 missense probably benign 0.25
R1468:Tnpo1 UTSW 13 98850157 missense probably benign 0.25
R1488:Tnpo1 UTSW 13 98856907 missense probably damaging 0.98
R1961:Tnpo1 UTSW 13 98852932 missense probably damaging 1.00
R3123:Tnpo1 UTSW 13 98867129 frame shift probably null
R3124:Tnpo1 UTSW 13 98867129 frame shift probably null
R4151:Tnpo1 UTSW 13 98852899 missense probably damaging 1.00
R4272:Tnpo1 UTSW 13 98867129 frame shift probably null
R4274:Tnpo1 UTSW 13 98867129 frame shift probably null
R5154:Tnpo1 UTSW 13 98870305 missense possibly damaging 0.84
R5763:Tnpo1 UTSW 13 98859937 missense possibly damaging 0.54
R5765:Tnpo1 UTSW 13 98859841 missense probably benign 0.08
R5827:Tnpo1 UTSW 13 98856908 missense probably damaging 1.00
R6240:Tnpo1 UTSW 13 98863829 missense probably damaging 1.00
R6279:Tnpo1 UTSW 13 98890708 missense possibly damaging 0.90
R6294:Tnpo1 UTSW 13 98890774 missense probably benign 0.03
R7055:Tnpo1 UTSW 13 98855479 missense possibly damaging 0.85
R7509:Tnpo1 UTSW 13 98870243 missense probably benign 0.00
R7707:Tnpo1 UTSW 13 98890787 missense probably benign 0.00
Z1088:Tnpo1 UTSW 13 98860670 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGGCTATGCTGTCCATCCC -3'
(R):5'- GAAAGTGGTCCTCTCTTTATCTTTG -3'

Sequencing Primer
(F):5'- ATGCTGTCCATCCCAACTGAAGTTAG -3'
(R):5'- TGACTTTAATCCCAGAGGCG -3'
Posted On2020-07-28