Incidental Mutation 'BB004:Scn4a'
ID642286
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #BB004
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106342383 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 454 (E454D)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably damaging
Transcript: ENSMUST00000021056
AA Change: E454D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: E454D

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T A 2: 91,421,905 D37V probably damaging Het
4921539E11Rik A G 4: 103,266,342 M111T probably benign Het
Adprhl1 C T 8: 13,248,682 V83I probably damaging Het
Agrn C T 4: 156,172,809 G1188D probably damaging Het
Amz2 A G 11: 109,429,058 K90R probably damaging Het
Arhgef4 G T 1: 34,807,253 Q227H probably damaging Het
B4galt3 T A 1: 171,271,772 C10* probably null Het
Banf2 T A 2: 144,073,798 M53K probably benign Het
BC034090 A T 1: 155,241,625 L249* probably null Het
Cftr A G 6: 18,267,971 D673G possibly damaging Het
Cntnap2 G T 6: 47,095,687 C1063F possibly damaging Het
Dnah3 A G 7: 119,951,271 I296T probably damaging Het
Dpy19l2 A G 9: 24,695,901 V88A probably benign Het
Fbln5 T C 12: 101,818,388 probably benign Het
Fbn1 T C 2: 125,383,736 D532G possibly damaging Het
Fnta G A 8: 26,004,426 R258* probably null Het
Gch1 G A 14: 47,155,923 H201Y probably damaging Het
Gm13023 T A 4: 143,792,966 I99N probably benign Het
Grik2 A T 10: 49,240,794 S624T probably damaging Het
Grm5 T A 7: 88,036,174 S500T probably benign Het
Hmcn1 T A 1: 150,609,775 I4359F probably damaging Het
Hrc T A 7: 45,336,053 H209Q possibly damaging Het
Hsd17b14 T C 7: 45,565,971 M164T probably damaging Het
Hydin T C 8: 110,580,844 F3952L possibly damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lig4 A T 8: 9,973,629 H50Q possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc4 A G 16: 32,771,637 T958A Het
Myo19 A G 11: 84,900,220 E419G probably damaging Het
Ndufa5 A G 6: 24,527,292 V16A possibly damaging Het
Olfr714 T C 7: 107,074,289 F154L probably benign Het
Phf24 A C 4: 42,934,774 T137P probably damaging Het
Pkp4 A T 2: 59,311,754 N467I probably damaging Het
Rbm12b2 C T 4: 12,095,417 R759C possibly damaging Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf34 T A 5: 122,850,225 probably benign Het
Scaf8 T A 17: 3,159,220 S73T unknown Het
Serpina1e A G 12: 103,951,191 V73A probably benign Het
Sh3rf2 A G 18: 42,111,422 T350A probably benign Het
Slc35a1 A G 4: 34,669,021 V264A probably damaging Het
Slf2 A G 19: 44,935,301 K185E probably damaging Het
Spsb2 T C 6: 124,809,373 F23S probably benign Het
Ssx2ip T G 3: 146,432,610 L404R probably damaging Het
Strn4 T A 7: 16,826,631 L236Q probably null Het
Tcp10b A G 17: 13,069,692 T202A probably benign Het
Tdp1 G T 12: 99,912,296 V448L probably damaging Het
Tecrl T C 5: 83,354,819 E61G probably damaging Het
Tepp T A 8: 95,313,158 S68T probably benign Het
Trim50 T C 5: 135,353,611 F106L probably benign Het
Usp5 G T 6: 124,824,229 F224L probably benign Het
Vmn2r114 G C 17: 23,291,645 N620K probably damaging Het
Vmn2r45 C A 7: 8,483,514 M258I probably benign Het
Zfp574 T A 7: 25,080,147 V198E probably benign Het
Zmym4 A G 4: 126,905,377 I722T probably benign Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
BB014:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 splice site probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
R7635:Scn4a UTSW 11 106324632 missense probably damaging 1.00
R7823:Scn4a UTSW 11 106342508 missense probably damaging 1.00
R7832:Scn4a UTSW 11 106322015 missense probably benign 0.01
R7927:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R8122:Scn4a UTSW 11 106330331 missense probably benign 0.02
R8131:Scn4a UTSW 11 106341541 missense probably benign
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Z1176:Scn4a UTSW 11 106321908 missense probably null 0.29
Z1176:Scn4a UTSW 11 106341529 missense probably benign 0.26
Z1176:Scn4a UTSW 11 106341530 missense probably damaging 0.97
Z1177:Scn4a UTSW 11 106330208 missense not run
Z1177:Scn4a UTSW 11 106341542 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTCCTGAGGCAGCAAAG -3'
(R):5'- AGACCGCTGATGCCTTTCTC -3'

Sequencing Primer
(F):5'- TGAGGCAGCAAAGCTCCC -3'
(R):5'- CCTTCTCTTCGCATCCCCAGAC -3'
Posted On2020-08-01