Incidental Mutation 'R8362:Megf8'
ID645996
Institutional Source Beutler Lab
Gene Symbol Megf8
Ensembl Gene ENSMUSG00000045039
Gene Namemultiple EGF-like-domains 8
SynonymsEgfl4, b2b1702Clo, m687Ddg, b2b288Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R8362 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25317164-25365917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25340518 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 986 (P986Q)
Ref Sequence ENSEMBL: ENSMUSP00000122192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128119]
Predicted Effect probably benign
Transcript: ENSMUST00000128119
AA Change: P986Q

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039
AA Change: P986Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit varying degrees of heterotaxia and congenital heart defects. Mice homozygous for another ENU-induced mutation exhibit abnormal development and patterning of the peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T A 19: 8,890,031 S65T probably damaging Het
Abcb1b A T 5: 8,798,758 N6I probably benign Het
Abr A T 11: 76,479,128 I145N probably benign Het
Alcam A T 16: 52,295,024 Y244N probably damaging Het
Amotl1 G A 9: 14,644,922 A36V probably benign Het
Ankrd11 A T 8: 122,892,058 L1685Q probably damaging Het
Ascc3 A C 10: 50,642,596 Q332H possibly damaging Het
Cdc42bpa C T 1: 180,162,125 L1720F probably damaging Het
Clec4b1 T C 6: 123,050,643 S20P probably benign Het
Cpt1a C T 19: 3,370,744 R401* probably null Het
Dnah12 T A 14: 26,854,831 Y3013N probably damaging Het
Dopey1 G A 9: 86,513,888 R801H probably benign Het
Flywch1 G T 17: 23,756,708 T520N probably damaging Het
Fndc1 A G 17: 7,782,375 S190P unknown Het
Gabra1 G T 11: 42,176,004 Q28K probably benign Het
Gm884 A G 11: 103,615,337 V1935A probably benign Het
Gria2 T C 3: 80,707,890 M428V possibly damaging Het
H13 T A 2: 152,686,391 I220N unknown Het
Hars2 T A 18: 36,790,175 F412L probably benign Het
Hecw2 A T 1: 54,040,491 M1K probably null Het
Homer1 T A 13: 93,366,289 S192T unknown Het
Itga2b T A 11: 102,461,363 D464V probably damaging Het
Ivd T A 2: 118,877,941 C379S probably damaging Het
Khdc3 A T 9: 73,103,566 N233Y possibly damaging Het
Lrrfip1 T A 1: 91,053,701 L15Q probably damaging Het
Morc2b G T 17: 33,138,321 T159K possibly damaging Het
Nudt5 A G 2: 5,853,511 probably null Het
Olfr801 G T 10: 129,670,231 A96E possibly damaging Het
Paqr5 A T 9: 61,972,663 Y116* probably null Het
Pcnx A C 12: 81,967,056 S623R Het
Polr1a T C 6: 71,964,667 V1053A probably benign Het
Ptprt A T 2: 161,551,747 D1252E probably damaging Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rasal1 C T 5: 120,675,420 R620W probably damaging Het
Rbms1 C T 2: 60,962,739 M9I probably benign Het
Ska3 T C 14: 57,816,648 N282D probably benign Het
Slc25a24 T A 3: 109,158,562 I245N possibly damaging Het
Slc26a4 C T 12: 31,544,507 V281I probably benign Het
Smg8 A T 11: 87,078,055 Y958* probably null Het
Spata31 A G 13: 64,922,230 T731A possibly damaging Het
Spg11 G T 2: 122,118,361 A3D unknown Het
Srgap1 A G 10: 121,855,478 Y284H possibly damaging Het
Stt3b A G 9: 115,254,920 I396T probably damaging Het
Tnxb A G 17: 34,712,972 T2160A probably damaging Het
Tprgl G C 4: 154,160,358 T91S possibly damaging Het
Ush2a G A 1: 188,957,453 V5071I probably damaging Het
Vmn2r60 T A 7: 42,195,530 N772K probably damaging Het
Vmn2r81 T A 10: 79,267,449 W159R probably benign Het
Vmn2r93 G A 17: 18,326,091 V742I probably benign Het
Zc3h13 C A 14: 75,324,469 H654N unknown Het
Zfp516 T C 18: 82,986,894 L641P probably benign Het
Zfp623 T C 15: 75,947,639 V148A probably damaging Het
Other mutations in Megf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Megf8 APN 7 25343684 missense possibly damaging 0.87
IGL00696:Megf8 APN 7 25342392 missense probably benign
IGL01021:Megf8 APN 7 25338374 missense probably benign 0.39
IGL01290:Megf8 APN 7 25349658 nonsense probably null
IGL01392:Megf8 APN 7 25363749 missense probably benign 0.03
IGL01410:Megf8 APN 7 25359871 missense probably benign 0.01
IGL01634:Megf8 APN 7 25358781 splice site probably benign
IGL01648:Megf8 APN 7 25327572 missense probably damaging 1.00
IGL01930:Megf8 APN 7 25334861 missense probably damaging 1.00
IGL01954:Megf8 APN 7 25349014 missense possibly damaging 0.94
IGL02150:Megf8 APN 7 25346417 splice site probably null
IGL02192:Megf8 APN 7 25353860 missense probably damaging 1.00
IGL02250:Megf8 APN 7 25342575 missense probably benign 0.02
IGL02301:Megf8 APN 7 25337900 missense probably damaging 0.96
IGL02317:Megf8 APN 7 25363788 missense probably damaging 1.00
IGL02324:Megf8 APN 7 25340448 missense probably benign 0.10
IGL02503:Megf8 APN 7 25363563 missense possibly damaging 0.70
IGL02583:Megf8 APN 7 25355793 missense probably benign
IGL02636:Megf8 APN 7 25358432 missense probably damaging 0.99
IGL02704:Megf8 APN 7 25359782 missense probably damaging 0.97
IGL02898:Megf8 APN 7 25346508 missense possibly damaging 0.79
IGL03082:Megf8 APN 7 25330236 missense probably benign
IGL03182:Megf8 APN 7 25347348 missense possibly damaging 0.92
megatherium UTSW 7 25342425 critical splice donor site probably null
PIT4810001:Megf8 UTSW 7 25342285 missense probably damaging 1.00
R0076:Megf8 UTSW 7 25353958 critical splice donor site probably null
R0217:Megf8 UTSW 7 25364079 missense probably damaging 0.99
R0514:Megf8 UTSW 7 25364303 missense possibly damaging 0.86
R0561:Megf8 UTSW 7 25328832 missense probably benign 0.21
R0563:Megf8 UTSW 7 25342395 missense probably damaging 1.00
R0601:Megf8 UTSW 7 25328540 missense probably benign 0.03
R0879:Megf8 UTSW 7 25338471 missense possibly damaging 0.58
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1430:Megf8 UTSW 7 25364343 missense possibly damaging 0.86
R1445:Megf8 UTSW 7 25342656 missense probably damaging 0.97
R1533:Megf8 UTSW 7 25334855 missense possibly damaging 0.70
R1606:Megf8 UTSW 7 25358695 missense probably damaging 1.00
R1635:Megf8 UTSW 7 25346747 missense possibly damaging 0.77
R1654:Megf8 UTSW 7 25338486 missense possibly damaging 0.56
R1661:Megf8 UTSW 7 25363847 missense probably damaging 1.00
R1880:Megf8 UTSW 7 25334860 missense possibly damaging 0.68
R1962:Megf8 UTSW 7 25363551 missense probably damaging 1.00
R2077:Megf8 UTSW 7 25353738 missense probably benign 0.15
R2127:Megf8 UTSW 7 25364582 missense possibly damaging 0.73
R2129:Megf8 UTSW 7 25330715 missense probably damaging 0.98
R2199:Megf8 UTSW 7 25339614 missense possibly damaging 0.87
R2201:Megf8 UTSW 7 25340745 missense probably damaging 1.00
R2205:Megf8 UTSW 7 25341748 missense probably benign 0.13
R2207:Megf8 UTSW 7 25349797 missense probably damaging 0.97
R2361:Megf8 UTSW 7 25348954 missense possibly damaging 0.94
R2680:Megf8 UTSW 7 25317556 missense probably benign 0.01
R3084:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3085:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3086:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3433:Megf8 UTSW 7 25360124 missense probably benign 0.00
R3939:Megf8 UTSW 7 25359202 missense probably benign 0.07
R4022:Megf8 UTSW 7 25337775 missense probably damaging 1.00
R4214:Megf8 UTSW 7 25355368 missense probably benign 0.03
R4357:Megf8 UTSW 7 25355749 missense probably benign 0.02
R4521:Megf8 UTSW 7 25342701 missense probably benign 0.19
R4620:Megf8 UTSW 7 25355098 missense possibly damaging 0.92
R4700:Megf8 UTSW 7 25363515 missense probably damaging 1.00
R4916:Megf8 UTSW 7 25339664 missense probably benign 0.24
R4940:Megf8 UTSW 7 25360706 missense probably damaging 1.00
R5048:Megf8 UTSW 7 25331092 missense possibly damaging 0.71
R5258:Megf8 UTSW 7 25348326 missense possibly damaging 0.88
R5271:Megf8 UTSW 7 25341706 missense probably damaging 1.00
R5390:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5391:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5708:Megf8 UTSW 7 25334597 missense probably benign 0.03
R5752:Megf8 UTSW 7 25355114 missense probably damaging 0.97
R5930:Megf8 UTSW 7 25326441 nonsense probably null
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6153:Megf8 UTSW 7 25347371 missense possibly damaging 0.93
R6210:Megf8 UTSW 7 25343720 missense possibly damaging 0.90
R6457:Megf8 UTSW 7 25349695 missense probably damaging 0.99
R6659:Megf8 UTSW 7 25358734 missense probably benign 0.38
R6867:Megf8 UTSW 7 25331035 missense probably benign 0.42
R6896:Megf8 UTSW 7 25329932 missense probably benign 0.00
R6899:Megf8 UTSW 7 25360713 missense probably damaging 1.00
R6905:Megf8 UTSW 7 25337932 missense probably benign 0.02
R7099:Megf8 UTSW 7 25346520 missense probably damaging 0.99
R7172:Megf8 UTSW 7 25343667 missense probably damaging 0.99
R7378:Megf8 UTSW 7 25348942 missense probably damaging 1.00
R7427:Megf8 UTSW 7 25338371 missense probably benign 0.44
R7492:Megf8 UTSW 7 25353848 missense probably benign 0.24
R7699:Megf8 UTSW 7 25329928 missense possibly damaging 0.91
R7700:Megf8 UTSW 7 25329928 missense possibly damaging 0.91
R7756:Megf8 UTSW 7 25342425 critical splice donor site probably null
R7758:Megf8 UTSW 7 25342425 critical splice donor site probably null
R7786:Megf8 UTSW 7 25317695 critical splice donor site probably null
R7797:Megf8 UTSW 7 25334597 missense probably damaging 0.99
R7881:Megf8 UTSW 7 25340635 missense possibly damaging 0.72
R8165:Megf8 UTSW 7 25353873 missense probably damaging 1.00
R8258:Megf8 UTSW 7 25358423 missense probably benign 0.03
R8259:Megf8 UTSW 7 25358423 missense probably benign 0.03
R8328:Megf8 UTSW 7 25347492 missense probably benign 0.05
R8680:Megf8 UTSW 7 25359741 critical splice acceptor site probably null
R9080:Megf8 UTSW 7 25341706 missense probably damaging 1.00
Z1088:Megf8 UTSW 7 25339669 missense possibly damaging 0.87
Z1177:Megf8 UTSW 7 25346162 missense probably damaging 1.00
Z1177:Megf8 UTSW 7 25347369 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGAAGAACCCAGAGGAATGC -3'
(R):5'- GGTTGTCTTCGTTGCCACAC -3'

Sequencing Primer
(F):5'- ACTCTGCAGCCAGTGAGTC -3'
(R):5'- TGGCTCTGCAGACACTCATGAC -3'
Posted On2020-09-02