Incidental Mutation 'R0015:Lypd1'
ID64883
Institutional Source Beutler Lab
Gene Symbol Lypd1
Ensembl Gene ENSMUSG00000026344
Gene NameLy6/Plaur domain containing 1
Synonyms2700050C12Rik, Lynx2, C530008O16Rik
MMRRC Submission 038310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0015 (G1)
Quality Score109
Status Validated
Chromosome1
Chromosomal Location125867622-125913101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125910438 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 48 (V48A)
Ref Sequence ENSEMBL: ENSMUSP00000125149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027582] [ENSMUST00000057846] [ENSMUST00000094609] [ENSMUST00000094610] [ENSMUST00000112583] [ENSMUST00000159417] [ENSMUST00000159529] [ENSMUST00000161361] [ENSMUST00000161954] [ENSMUST00000162877] [ENSMUST00000162899]
Predicted Effect probably benign
Transcript: ENSMUST00000027582
SMART Domains Protein: ENSMUSP00000027582
Gene: ENSMUSG00000026344

DomainStartEndE-ValueType
LU 24 122 5.18e-2 SMART
low complexity region 126 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057846
SMART Domains Protein: ENSMUSP00000062229
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 950 971 N/A INTRINSIC
low complexity region 1070 1085 N/A INTRINSIC
low complexity region 1181 1200 N/A INTRINSIC
Pfam:NCKAP5 1298 1602 1.8e-120 PFAM
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1757 1771 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094609
SMART Domains Protein: ENSMUSP00000092192
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
Pfam:NCKAP5 113 364 3.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094610
SMART Domains Protein: ENSMUSP00000092193
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 1 101 8.8e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112583
SMART Domains Protein: ENSMUSP00000108202
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 70 93 N/A INTRINSIC
coiled coil region 176 254 N/A INTRINSIC
low complexity region 301 324 N/A INTRINSIC
low complexity region 453 464 N/A INTRINSIC
low complexity region 887 903 N/A INTRINSIC
low complexity region 1082 1103 N/A INTRINSIC
low complexity region 1202 1217 N/A INTRINSIC
low complexity region 1313 1332 N/A INTRINSIC
Pfam:NCKAP5 1431 1733 5.3e-119 PFAM
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1889 1903 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159417
AA Change: V48A

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125149
Gene: ENSMUSG00000026344
AA Change: V48A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LU 23 121 2.5e-4 SMART
low complexity region 125 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159529
SMART Domains Protein: ENSMUSP00000123824
Gene: ENSMUSG00000026344

DomainStartEndE-ValueType
Blast:LU 1 69 4e-32 BLAST
low complexity region 73 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160736
Predicted Effect probably benign
Transcript: ENSMUST00000161361
Predicted Effect probably benign
Transcript: ENSMUST00000161954
SMART Domains Protein: ENSMUSP00000125624
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
coiled coil region 108 186 N/A INTRINSIC
low complexity region 233 256 N/A INTRINSIC
low complexity region 385 396 N/A INTRINSIC
low complexity region 819 835 N/A INTRINSIC
low complexity region 1014 1035 N/A INTRINSIC
low complexity region 1134 1149 N/A INTRINSIC
low complexity region 1245 1264 N/A INTRINSIC
Pfam:NCKAP5 1362 1666 2.1e-120 PFAM
low complexity region 1792 1806 N/A INTRINSIC
low complexity region 1821 1835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162877
SMART Domains Protein: ENSMUSP00000124748
Gene: ENSMUSG00000049690

DomainStartEndE-ValueType
Pfam:NCKAP5 9 296 6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162899
SMART Domains Protein: ENSMUSP00000125158
Gene: ENSMUSG00000026344

DomainStartEndE-ValueType
Blast:LU 1 69 4e-32 BLAST
low complexity region 73 89 N/A INTRINSIC
Meta Mutation Damage Score 0.1420 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased fear and anxiety behaviors with increased spontaneous excitatory postsynaptic current following nicotine treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Lypd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Lypd1 UTSW 1 125910537 splice site probably benign
R0537:Lypd1 UTSW 1 125912867 unclassified probably benign
R1838:Lypd1 UTSW 1 125873371 unclassified probably benign
R2045:Lypd1 UTSW 1 125910535 splice site probably benign
R3757:Lypd1 UTSW 1 125910384 splice site probably benign
R6906:Lypd1 UTSW 1 125910459 missense probably damaging 0.99
R7453:Lypd1 UTSW 1 125873566 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGAAGAAGCCCTGGCAATTAAC -3'
(R):5'- GCTCTGTGCAAGCCAGATCTTAACC -3'

Sequencing Primer
(F):5'- ATCTGTGCTAACCAgtgagtg -3'
(R):5'- CAAGCCAGATCTTAACCAGTGTTTC -3'
Posted On2013-08-06