Incidental Mutation 'R8461:Atp6v0a1'
ID655291
Institutional Source Beutler Lab
Gene Symbol Atp6v0a1
Ensembl Gene ENSMUSG00000019302
Gene NameATPase, H+ transporting, lysosomal V0 subunit A1
SynonymsAtp6n1a, Vpp-1, Vpp1, V-ATPase a1, Atp6n1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8461 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101009452-101063719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101044574 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 653 (L653R)
Ref Sequence ENSEMBL: ENSMUSP00000044838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044721
AA Change: L653R

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: L653R

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092663
AA Change: L653R

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: L653R

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 823 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103110
AA Change: L660R

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: L660R

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168757
AA Change: L653R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: L653R

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4921539E11Rik T C 4: 103,255,515 D132G probably benign Het
Abca16 T C 7: 120,436,695 F334L possibly damaging Het
Ache T C 5: 137,290,320 F96S probably damaging Het
Actg1 T C 11: 120,348,184 T27A unknown Het
Ankrd27 T C 7: 35,627,486 L752P probably damaging Het
Atp1a1 T A 3: 101,589,089 T417S probably benign Het
Aurkb T C 11: 69,050,901 V293A probably damaging Het
C2cd5 A T 6: 143,035,076 D654E probably damaging Het
Cacna1s T C 1: 136,073,702 V297A possibly damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccdc187 A G 2: 26,293,802 L62P probably damaging Het
Cdh2 A G 18: 16,650,465 V69A probably benign Het
D430041D05Rik A G 2: 104,167,935 V1156A possibly damaging Het
Defb37 G A 8: 18,986,370 H45Y unknown Het
Dgke T C 11: 89,048,993 M367V possibly damaging Het
Dnah1 T C 14: 31,305,958 K640R probably benign Het
Gm5478 A T 15: 101,646,217 L148Q probably damaging Het
Hhla1 A T 15: 65,923,874 S494R probably benign Het
Kcne4 G A 1: 78,817,716 S27N probably benign Het
Klhdc7b A T 15: 89,387,621 H244L probably damaging Het
Lrrc40 T C 3: 158,058,734 S429P possibly damaging Het
Map3k21 A T 8: 125,944,622 D883V probably benign Het
Med4 T C 14: 73,518,028 S259P unknown Het
Mrm3 T C 11: 76,244,332 I123T probably damaging Het
Mrpl1 T A 5: 96,213,787 V11D probably damaging Het
Myl1 G A 1: 66,944,835 P24L unknown Het
Necap2 T C 4: 141,070,220 K168R probably damaging Het
Nnt A G 13: 119,368,502 S559P unknown Het
Nox4 T C 7: 87,317,271 F197L probably damaging Het
Nup93 T C 8: 94,281,335 probably null Het
Nxph2 T C 2: 23,321,517 V10A unknown Het
Olfr1 T A 11: 73,395,156 I289F probably damaging Het
Olfr1085 G A 2: 86,657,546 T304I probably benign Het
Olfr251 T A 9: 38,378,481 V194D probably damaging Het
P2ry2 G T 7: 100,998,688 R137S possibly damaging Het
Plxnb3 T C X: 73,759,497 Y324H probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Ppme1 T C 7: 100,371,805 S7G probably benign Het
Rabep1 T A 11: 70,884,855 M85K possibly damaging Het
Ranbp2 T C 10: 58,476,394 Y979H probably damaging Het
Rapgef5 T C 12: 117,714,109 S360P probably benign Het
Rbm33 T A 5: 28,387,972 H623Q probably damaging Het
Rev1 G T 1: 38,083,787 T450K possibly damaging Het
Sec23ip T A 7: 128,772,202 L716Q probably benign Het
Sp2 T C 11: 96,955,913 T535A possibly damaging Het
Syne1 A G 10: 5,061,463 S61P probably benign Het
Tcf4 T C 18: 69,465,430 V72A probably benign Het
Tmem131 G A 1: 36,794,821 S1726F probably damaging Het
Trim13 T C 14: 61,605,472 Y313H probably benign Het
Ttn A G 2: 76,781,093 V17365A possibly damaging Het
Uap1l1 G A 2: 25,365,410 A69V probably benign Het
Upp2 A G 2: 58,780,056 D258G probably benign Het
Vmn1r44 A T 6: 89,893,719 H149L possibly damaging Het
Zbtb49 T C 5: 38,201,109 D600G probably benign Het
Zfp869 G T 8: 69,707,655 H89Q probably benign Het
Other mutations in Atp6v0a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Atp6v0a1 APN 11 101030505 critical splice donor site probably null
IGL01024:Atp6v0a1 APN 11 101048439 missense probably benign 0.00
IGL01390:Atp6v0a1 APN 11 101043802 missense probably benign 0.01
IGL02214:Atp6v0a1 APN 11 101039840 missense probably benign 0.01
IGL02639:Atp6v0a1 APN 11 101055518 missense possibly damaging 0.90
R0125:Atp6v0a1 UTSW 11 101038851 splice site probably null
R0193:Atp6v0a1 UTSW 11 101048482 missense possibly damaging 0.90
R0265:Atp6v0a1 UTSW 11 101048515 missense possibly damaging 0.80
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0974:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R1460:Atp6v0a1 UTSW 11 101033998 missense probably damaging 1.00
R1580:Atp6v0a1 UTSW 11 101029204 missense probably damaging 1.00
R1625:Atp6v0a1 UTSW 11 101055554 missense probably damaging 1.00
R1644:Atp6v0a1 UTSW 11 101038786 missense possibly damaging 0.65
R1779:Atp6v0a1 UTSW 11 101026685 missense probably benign 0.01
R2895:Atp6v0a1 UTSW 11 101044598 missense probably benign
R2926:Atp6v0a1 UTSW 11 101043948 missense probably damaging 0.99
R3727:Atp6v0a1 UTSW 11 101030420 missense probably benign 0.01
R3943:Atp6v0a1 UTSW 11 101055517 missense probably benign 0.00
R4820:Atp6v0a1 UTSW 11 101042950 missense probably benign 0.00
R5119:Atp6v0a1 UTSW 11 101020515 missense probably benign 0.02
R5250:Atp6v0a1 UTSW 11 101043044 missense possibly damaging 0.94
R5377:Atp6v0a1 UTSW 11 101055587 missense probably damaging 1.00
R5393:Atp6v0a1 UTSW 11 101038807 missense possibly damaging 0.95
R5497:Atp6v0a1 UTSW 11 101029185 missense probably damaging 1.00
R5787:Atp6v0a1 UTSW 11 101018574 missense probably benign 0.04
R6054:Atp6v0a1 UTSW 11 101039889 missense possibly damaging 0.91
R6076:Atp6v0a1 UTSW 11 101055060 missense probably damaging 1.00
R6889:Atp6v0a1 UTSW 11 101029183 missense possibly damaging 0.87
R7035:Atp6v0a1 UTSW 11 101027357 missense probably damaging 0.97
R7084:Atp6v0a1 UTSW 11 101034042 missense probably damaging 1.00
R7212:Atp6v0a1 UTSW 11 101043957 missense probably benign 0.08
R8289:Atp6v0a1 UTSW 11 101034105 missense probably damaging 1.00
R8680:Atp6v0a1 UTSW 11 101062403 makesense probably null
R8725:Atp6v0a1 UTSW 11 101029189 missense possibly damaging 0.94
R8727:Atp6v0a1 UTSW 11 101029189 missense possibly damaging 0.94
R8935:Atp6v0a1 UTSW 11 101038693 missense possibly damaging 0.90
X0023:Atp6v0a1 UTSW 11 101044597 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACACTTACTGGGTTTGTCCTGG -3'
(R):5'- GGGTTCATGCTCATATGTAACCC -3'

Sequencing Primer
(F):5'- CTGGTGCCAGCTCATTACTTAGAG -3'
(R):5'- TTCATGCTCATATGTAACCCAAATCC -3'
Posted On2020-10-20