Incidental Mutation 'R8511:6430548M08Rik'
ID 655876
Institutional Source Beutler Lab
Gene Symbol 6430548M08Rik
Ensembl Gene ENSMUSG00000031824
Gene Name RIKEN cDNA 6430548M08 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock # R8511 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 120114152-120165306 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120152562 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 233 (N233S)
Ref Sequence ENSEMBL: ENSMUSP00000034281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034281] [ENSMUST00000108948] [ENSMUST00000108950] [ENSMUST00000108951] [ENSMUST00000127664] [ENSMUST00000153725]
AlphaFold Q8R0A7
Predicted Effect probably benign
Transcript: ENSMUST00000034281
AA Change: N233S

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034281
Gene: ENSMUSG00000031824
AA Change: N233S

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108948
AA Change: N233S

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104576
Gene: ENSMUSG00000031824
AA Change: N233S

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108950
AA Change: N233S

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104578
Gene: ENSMUSG00000031824
AA Change: N233S

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108951
AA Change: N233S

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104579
Gene: ENSMUSG00000031824
AA Change: N233S

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153725
SMART Domains Protein: ENSMUSP00000114976
Gene: ENSMUSG00000031824

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 68 87 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik T C 11: 11,590,056 H186R unknown Het
4931409K22Rik T A 5: 24,545,908 H559L possibly damaging Het
Acan A G 7: 79,097,935 D818G possibly damaging Het
Adam22 G A 5: 8,134,558 T478I probably damaging Het
Agmo T A 12: 37,244,397 *115R probably null Het
Ahnak A G 19: 9,012,355 K3668E unknown Het
Aldh6a1 G A 12: 84,433,971 T430I possibly damaging Het
Ankrd11 T C 8: 122,899,729 D17G Het
Apol10b C G 15: 77,585,010 E322D probably benign Het
Apol10b T C 15: 77,585,011 E322G probably benign Het
Apol8 C T 15: 77,750,073 G101E probably benign Het
Arhgef26 A T 3: 62,428,929 M630L probably damaging Het
Aspm T C 1: 139,457,308 L230P probably damaging Het
Atg101 T C 15: 101,290,622 S203P probably damaging Het
Baz2b T A 2: 59,901,814 T1996S probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cad A G 5: 31,075,821 K1869R probably benign Het
Caskin1 A T 17: 24,505,936 I1233F probably benign Het
Ckap5 T A 2: 91,615,147 L1770I possibly damaging Het
Clip1 T C 5: 123,653,906 N67S possibly damaging Het
Csmd2 A G 4: 128,368,899 N626S Het
Cuedc2 C A 19: 46,330,919 probably null Het
Dmbt1 A T 7: 131,102,012 N1275Y unknown Het
Dnm3 A G 1: 162,286,042 V483A possibly damaging Het
Dock9 A T 14: 121,627,389 H718Q probably benign Het
Dock9 T C 14: 121,681,435 D50G probably damaging Het
Egfr T G 11: 16,896,949 I782S probably damaging Het
Elmod1 A T 9: 53,912,811 F298I probably damaging Het
Enthd1 T C 15: 80,474,227 Q364R probably damaging Het
Fat2 T A 11: 55,309,237 S1004C probably damaging Het
Fga A T 3: 83,031,757 K480* probably null Het
Fhod3 A G 18: 25,132,937 T1561A probably damaging Het
Foxg1 T A 12: 49,385,085 Y200* probably null Het
Foxj2 C T 6: 122,831,445 R115* probably null Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm15922 A G 7: 3,739,348 L60P probably damaging Het
Gpsm2 A G 3: 108,682,083 S580P probably benign Het
Hectd1 A G 12: 51,787,871 S870P probably benign Het
Hic2 T A 16: 17,258,010 N234K possibly damaging Het
Ica1 A G 6: 8,754,726 F15L probably benign Het
Immp1l G A 2: 105,930,755 R3H probably benign Het
Jak3 T A 8: 71,685,550 Y882N probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Luzp1 A G 4: 136,541,339 D291G probably damaging Het
Map3k19 C T 1: 127,847,418 E61K possibly damaging Het
Mical3 A G 6: 121,038,552 I175T possibly damaging Het
Nectin3 G A 16: 46,464,000 P107L probably damaging Het
Olfr975 A G 9: 39,950,159 V204A probably benign Het
Polr1a C A 6: 71,920,520 H207N probably benign Het
Prokr2 A G 2: 132,381,502 V40A probably benign Het
Prtg T C 9: 72,890,874 probably null Het
Ptprs G A 17: 56,447,440 T200I probably damaging Het
Ramp3 C T 11: 6,676,709 R139C probably benign Het
Scfd2 A G 5: 74,212,288 V642A possibly damaging Het
Scn11a T C 9: 119,789,915 K787R probably damaging Het
Slco3a1 A G 7: 74,303,242 V523A probably benign Het
Smo A G 6: 29,755,532 Y401C probably damaging Het
Spata5 A G 3: 37,436,748 M481V probably damaging Het
Stmn2 A G 3: 8,509,555 probably benign Het
Stra6l G T 4: 45,885,347 G605V probably benign Het
Syne2 A G 12: 76,008,873 I4170V probably benign Het
Tgm7 T A 2: 121,093,660 I594F probably damaging Het
Tle2 T C 10: 81,587,996 L648P probably damaging Het
Tmprss2 G T 16: 97,568,462 L371I possibly damaging Het
Ttn T C 2: 76,749,522 R23676G probably damaging Het
Tvp23b T C 11: 62,883,737 I69T possibly damaging Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 A T 17: 19,394,181 D721V probably damaging Het
Zan A T 5: 137,446,846 V1717E unknown Het
Zmiz2 C T 11: 6,403,190 H658Y probably damaging Het
Other mutations in 6430548M08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02861:6430548M08Rik APN 8 120150124 missense probably damaging 1.00
R0137:6430548M08Rik UTSW 8 120151376 missense possibly damaging 0.87
R1019:6430548M08Rik UTSW 8 120145470 missense probably damaging 0.98
R1140:6430548M08Rik UTSW 8 120150135 missense probably damaging 1.00
R2026:6430548M08Rik UTSW 8 120153466 missense probably benign 0.00
R2209:6430548M08Rik UTSW 8 120157488 missense possibly damaging 0.73
R2508:6430548M08Rik UTSW 8 120145393 missense probably benign 0.03
R2884:6430548M08Rik UTSW 8 120145511 missense possibly damaging 0.94
R3724:6430548M08Rik UTSW 8 120149360 missense probably damaging 1.00
R3944:6430548M08Rik UTSW 8 120152502 missense probably damaging 1.00
R4584:6430548M08Rik UTSW 8 120160017 missense probably damaging 1.00
R4668:6430548M08Rik UTSW 8 120160414 critical splice donor site probably null
R5883:6430548M08Rik UTSW 8 120145641 missense probably damaging 0.98
R6621:6430548M08Rik UTSW 8 120145423 missense possibly damaging 0.60
R6919:6430548M08Rik UTSW 8 120145482 missense probably damaging 1.00
R7023:6430548M08Rik UTSW 8 120145357 missense probably damaging 1.00
R7035:6430548M08Rik UTSW 8 120152486 missense probably damaging 1.00
R7218:6430548M08Rik UTSW 8 120145583 missense probably damaging 1.00
R7343:6430548M08Rik UTSW 8 120145588 missense probably benign
R7424:6430548M08Rik UTSW 8 120145545 missense probably damaging 1.00
R7711:6430548M08Rik UTSW 8 120159984 missense possibly damaging 0.91
R9009:6430548M08Rik UTSW 8 120151540 intron probably benign
Predicted Primers PCR Primer
(F):5'- TACCCTGTTGAGGAGACTGAGG -3'
(R):5'- GACAGCATGTGGAAGCTCTG -3'

Sequencing Primer
(F):5'- TCCCTGGGAAGCACCTTCAG -3'
(R):5'- AAGCTCTGGGGTGCAGAGTC -3'
Posted On 2020-10-20