Incidental Mutation 'R8511:Spata5'
ID 655851
Institutional Source Beutler Lab
Gene Symbol Spata5
Ensembl Gene ENSMUSG00000027722
Gene Name spermatogenesis associated 5
Synonyms C78064, 2510048F20Rik, Spaf
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8511 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 37419896-37579096 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37436748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 481 (M481V)
Ref Sequence ENSEMBL: ENSMUSP00000103747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029277] [ENSMUST00000108112] [ENSMUST00000198968]
AlphaFold Q3UMC0
Predicted Effect probably damaging
Transcript: ENSMUST00000029277
AA Change: M480V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029277
Gene: ENSMUSG00000027722
AA Change: M480V

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 135 2.47e-1 SMART
low complexity region 276 287 N/A INTRINSIC
AAA 385 524 4.96e-21 SMART
Blast:AAA 553 622 9e-21 BLAST
AAA 659 797 2.48e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108112
AA Change: M481V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103747
Gene: ENSMUSG00000027722
AA Change: M481V

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 136 1.14e0 SMART
low complexity region 277 288 N/A INTRINSIC
AAA 386 525 4.96e-21 SMART
Blast:AAA 554 623 9e-21 BLAST
AAA 660 798 2.48e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198968
AA Change: M481V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143349
Gene: ENSMUSG00000027722
AA Change: M481V

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
CDC48_N 44 136 8.6e-5 SMART
low complexity region 277 288 N/A INTRINSIC
AAA 386 525 8.2e-23 SMART
Blast:AAA 554 623 7e-21 BLAST
AAA 660 798 4e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATPase associated with diverse activities family, whose members are defined by a highly conserved ATPase domain. Members of this family participate in diverse cellular processes that include membrane fusion, DNA replication, microtubule severing, and protein degradation. The protein encoded by this gene has a putative mitochondrial targeting sequence and has been proposed to function in maintenance of mitochondrial function and integrity during mouse spermatogenesis. Allelic variants in this gene have been associated with epilepsy, hearing loss, and mental retardation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik T C 11: 11,590,056 H186R unknown Het
4931409K22Rik T A 5: 24,545,908 H559L possibly damaging Het
6430548M08Rik A G 8: 120,152,562 N233S probably benign Het
Acan A G 7: 79,097,935 D818G possibly damaging Het
Adam22 G A 5: 8,134,558 T478I probably damaging Het
Agmo T A 12: 37,244,397 *115R probably null Het
Ahnak A G 19: 9,012,355 K3668E unknown Het
Aldh6a1 G A 12: 84,433,971 T430I possibly damaging Het
Ankrd11 T C 8: 122,899,729 D17G Het
Apol10b C G 15: 77,585,010 E322D probably benign Het
Apol10b T C 15: 77,585,011 E322G probably benign Het
Apol8 C T 15: 77,750,073 G101E probably benign Het
Arhgef26 A T 3: 62,428,929 M630L probably damaging Het
Aspm T C 1: 139,457,308 L230P probably damaging Het
Atg101 T C 15: 101,290,622 S203P probably damaging Het
Baz2b T A 2: 59,901,814 T1996S probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cad A G 5: 31,075,821 K1869R probably benign Het
Caskin1 A T 17: 24,505,936 I1233F probably benign Het
Ckap5 T A 2: 91,615,147 L1770I possibly damaging Het
Clip1 T C 5: 123,653,906 N67S possibly damaging Het
Csmd2 A G 4: 128,368,899 N626S Het
Cuedc2 C A 19: 46,330,919 probably null Het
Dmbt1 A T 7: 131,102,012 N1275Y unknown Het
Dnm3 A G 1: 162,286,042 V483A possibly damaging Het
Dock9 A T 14: 121,627,389 H718Q probably benign Het
Dock9 T C 14: 121,681,435 D50G probably damaging Het
Egfr T G 11: 16,896,949 I782S probably damaging Het
Elmod1 A T 9: 53,912,811 F298I probably damaging Het
Enthd1 T C 15: 80,474,227 Q364R probably damaging Het
Fat2 T A 11: 55,309,237 S1004C probably damaging Het
Fga A T 3: 83,031,757 K480* probably null Het
Fhod3 A G 18: 25,132,937 T1561A probably damaging Het
Foxg1 T A 12: 49,385,085 Y200* probably null Het
Foxj2 C T 6: 122,831,445 R115* probably null Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm15922 A G 7: 3,739,348 L60P probably damaging Het
Gpsm2 A G 3: 108,682,083 S580P probably benign Het
Hectd1 A G 12: 51,787,871 S870P probably benign Het
Hic2 T A 16: 17,258,010 N234K possibly damaging Het
Ica1 A G 6: 8,754,726 F15L probably benign Het
Immp1l G A 2: 105,930,755 R3H probably benign Het
Jak3 T A 8: 71,685,550 Y882N probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Luzp1 A G 4: 136,541,339 D291G probably damaging Het
Map3k19 C T 1: 127,847,418 E61K possibly damaging Het
Mical3 A G 6: 121,038,552 I175T possibly damaging Het
Nectin3 G A 16: 46,464,000 P107L probably damaging Het
Olfr975 A G 9: 39,950,159 V204A probably benign Het
Polr1a C A 6: 71,920,520 H207N probably benign Het
Prokr2 A G 2: 132,381,502 V40A probably benign Het
Prtg T C 9: 72,890,874 probably null Het
Ptprs G A 17: 56,447,440 T200I probably damaging Het
Ramp3 C T 11: 6,676,709 R139C probably benign Het
Scfd2 A G 5: 74,212,288 V642A possibly damaging Het
Scn11a T C 9: 119,789,915 K787R probably damaging Het
Slco3a1 A G 7: 74,303,242 V523A probably benign Het
Smo A G 6: 29,755,532 Y401C probably damaging Het
Stmn2 A G 3: 8,509,555 probably benign Het
Stra6l G T 4: 45,885,347 G605V probably benign Het
Syne2 A G 12: 76,008,873 I4170V probably benign Het
Tgm7 T A 2: 121,093,660 I594F probably damaging Het
Tle2 T C 10: 81,587,996 L648P probably damaging Het
Tmprss2 G T 16: 97,568,462 L371I possibly damaging Het
Ttn T C 2: 76,749,522 R23676G probably damaging Het
Tvp23b T C 11: 62,883,737 I69T possibly damaging Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 A T 17: 19,394,181 D721V probably damaging Het
Zan A T 5: 137,446,846 V1717E unknown Het
Zmiz2 C T 11: 6,403,190 H658Y probably damaging Het
Other mutations in Spata5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Spata5 APN 3 37451802 missense possibly damaging 0.60
IGL00472:Spata5 APN 3 37436644 missense probably benign
IGL02664:Spata5 APN 3 37436665 missense probably damaging 1.00
IGL02797:Spata5 APN 3 37458316 splice site probably benign
IGL02869:Spata5 APN 3 37464545 missense probably damaging 1.00
IGL02891:Spata5 APN 3 37426192 missense probably damaging 0.97
IGL03065:Spata5 APN 3 37432179 missense possibly damaging 0.75
IGL03121:Spata5 APN 3 37464651 missense probably damaging 1.00
IGL03178:Spata5 APN 3 37578783 missense probably damaging 1.00
R0494:Spata5 UTSW 3 37432163 missense possibly damaging 0.79
R0621:Spata5 UTSW 3 37432029 missense probably benign 0.06
R0908:Spata5 UTSW 3 37431623 splice site probably null
R1773:Spata5 UTSW 3 37439185 missense probably damaging 0.99
R2016:Spata5 UTSW 3 37578762 missense possibly damaging 0.48
R3714:Spata5 UTSW 3 37433209 missense probably benign
R3836:Spata5 UTSW 3 37433643 missense possibly damaging 0.91
R4548:Spata5 UTSW 3 37432027 missense probably benign 0.03
R4695:Spata5 UTSW 3 37458325 missense probably damaging 1.00
R4758:Spata5 UTSW 3 37433236 missense probably benign 0.01
R5009:Spata5 UTSW 3 37433277 splice site probably benign
R5839:Spata5 UTSW 3 37464654 missense probably damaging 1.00
R6437:Spata5 UTSW 3 37528198 missense probably damaging 1.00
R7067:Spata5 UTSW 3 37431698 nonsense probably null
R7450:Spata5 UTSW 3 37456785 missense probably damaging 1.00
R7889:Spata5 UTSW 3 37578810 missense probably benign 0.01
R7898:Spata5 UTSW 3 37420471 missense probably benign 0.04
R8108:Spata5 UTSW 3 37431782 missense probably benign 0.25
R8870:Spata5 UTSW 3 37448512 missense probably benign 0.35
R8941:Spata5 UTSW 3 37431993 missense probably damaging 0.97
Z1176:Spata5 UTSW 3 37431750 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GTTATGAAGGCAGATATATGCTGG -3'
(R):5'- CACTTATTGACACCTGCCTCAG -3'

Sequencing Primer
(F):5'- CAGATATATGCTGGAATATGAGGTTG -3'
(R):5'- CCTGCCTCAGGTTTTAAATTACTATC -3'
Posted On 2020-10-20