Mutagenetix > Incidental Mutations

Incidental Mutation 'R8511:Ptprs'

655908

Institutional Source

Beutler Lab

Gene Symbol

Ptprs

Ensembl Gene

ENSMUSG00000013236

Gene Name

protein tyrosine phosphatase, receptor type, S

Synonyms

Ptpt9, PTP-NU3, RPTPsigma, PTPsigma

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8511 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

56412426-56476483 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 56447440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 200 (T200I)

Ref Sequence

ENSEMBL: ENSMUSP00000064048 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223859]

AlphaFold

B0V2N1

PDB Structure

Crystal structure of mouse PTPsigma [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000067538
AA Change: T200I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: T200I

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
IGc2	45	114	3.38e-10	SMART
IGc2	147	214	2.4e-15	SMART
IGc2	244	305	8.26e-5	SMART
FN3	319	398	2.8e-14	SMART
FN3	414	497	3.24e-10	SMART
FN3	512	590	3.17e-13	SMART
FN3	605	692	9.69e-9	SMART
FN3	707	796	2.42e-9	SMART
FN3	811	890	2.22e0	SMART
FN3	905	995	8.31e-8	SMART
FN3	1009	1085	3.22e-5	SMART
low complexity region	1164	1177	N/A	INTRINSIC
transmembrane domain	1259	1281	N/A	INTRINSIC
PTPc	1351	1609	1.54e-136	SMART
PTPc	1638	1900	3.12e-128	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000086828
AA Change: T200I

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236
AA Change: T200I

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
IGc2	45	114	3.38e-10	SMART
IGc2	147	214	2.4e-15	SMART
IGc2	244	305	8.26e-5	SMART
FN3	319	398	2.8e-14	SMART
FN3	414	497	3.24e-10	SMART
FN3	512	590	3.17e-13	SMART
FN3	603	679	2.54e-3	SMART
low complexity region	758	771	N/A	INTRINSIC
transmembrane domain	853	875	N/A	INTRINSIC
PTPc	945	1203	1.54e-136	SMART
PTPc	1232	1494	3.12e-128	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000223859
AA Change: T200I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930512M02Rik	T	C	11: 11,590,056	H186R	unknown	Het
4931409K22Rik	T	A	5: 24,545,908	H559L	possibly damaging	Het
6430548M08Rik	A	G	8: 120,152,562	N233S	probably benign	Het
Acan	A	G	7: 79,097,935	D818G	possibly damaging	Het
Adam22	G	A	5: 8,134,558	T478I	probably damaging	Het
Agmo	T	A	12: 37,244,397	*115R	probably null	Het
Ahnak	A	G	19: 9,012,355	K3668E	unknown	Het
Aldh6a1	G	A	12: 84,433,971	T430I	possibly damaging	Het
Ankrd11	T	C	8: 122,899,729	D17G		Het
Apol10b	C	G	15: 77,585,010	E322D	probably benign	Het
Apol10b	T	C	15: 77,585,011	E322G	probably benign	Het
Apol8	C	T	15: 77,750,073	G101E	probably benign	Het
Arhgef26	A	T	3: 62,428,929	M630L	probably damaging	Het
Aspm	T	C	1: 139,457,308	L230P	probably damaging	Het
Atg101	T	C	15: 101,290,622	S203P	probably damaging	Het
Baz2b	T	A	2: 59,901,814	T1996S	probably benign	Het
Brwd1	A	T	16: 96,058,738	M350K	probably damaging	Het
Cad	A	G	5: 31,075,821	K1869R	probably benign	Het
Caskin1	A	T	17: 24,505,936	I1233F	probably benign	Het
Ckap5	T	A	2: 91,615,147	L1770I	possibly damaging	Het
Clip1	T	C	5: 123,653,906	N67S	possibly damaging	Het
Csmd2	A	G	4: 128,368,899	N626S		Het
Cuedc2	C	A	19: 46,330,919		probably null	Het
Dmbt1	A	T	7: 131,102,012	N1275Y	unknown	Het
Dnm3	A	G	1: 162,286,042	V483A	possibly damaging	Het
Dock9	A	T	14: 121,627,389	H718Q	probably benign	Het
Dock9	T	C	14: 121,681,435	D50G	probably damaging	Het
Egfr	T	G	11: 16,896,949	I782S	probably damaging	Het
Elmod1	A	T	9: 53,912,811	F298I	probably damaging	Het
Enthd1	T	C	15: 80,474,227	Q364R	probably damaging	Het
Fat2	T	A	11: 55,309,237	S1004C	probably damaging	Het
Fga	A	T	3: 83,031,757	K480*	probably null	Het
Fhod3	A	G	18: 25,132,937	T1561A	probably damaging	Het
Foxg1	T	A	12: 49,385,085	Y200*	probably null	Het
Foxj2	C	T	6: 122,831,445	R115*	probably null	Het
Ggnbp2	C	T	11: 84,837,989		probably null	Het
Gm15922	A	G	7: 3,739,348	L60P	probably damaging	Het
Gpsm2	A	G	3: 108,682,083	S580P	probably benign	Het
Hectd1	A	G	12: 51,787,871	S870P	probably benign	Het
Hic2	T	A	16: 17,258,010	N234K	possibly damaging	Het
Ica1	A	G	6: 8,754,726	F15L	probably benign	Het
Immp1l	G	A	2: 105,930,755	R3H	probably benign	Het
Jak3	T	A	8: 71,685,550	Y882N	probably damaging	Het
Klk1b1	C	T	7: 43,970,343	R109C	possibly damaging	Het
Luzp1	A	G	4: 136,541,339	D291G	probably damaging	Het
Map3k19	C	T	1: 127,847,418	E61K	possibly damaging	Het
Mical3	A	G	6: 121,038,552	I175T	possibly damaging	Het
Nectin3	G	A	16: 46,464,000	P107L	probably damaging	Het
Olfr975	A	G	9: 39,950,159	V204A	probably benign	Het
Polr1a	C	A	6: 71,920,520	H207N	probably benign	Het
Prokr2	A	G	2: 132,381,502	V40A	probably benign	Het
Prtg	T	C	9: 72,890,874		probably null	Het
Ramp3	C	T	11: 6,676,709	R139C	probably benign	Het
Scfd2	A	G	5: 74,212,288	V642A	possibly damaging	Het
Scn11a	T	C	9: 119,789,915	K787R	probably damaging	Het
Slco3a1	A	G	7: 74,303,242	V523A	probably benign	Het
Smo	A	G	6: 29,755,532	Y401C	probably damaging	Het
Spata5	A	G	3: 37,436,748	M481V	probably damaging	Het
Stmn2	A	G	3: 8,509,555		probably benign	Het
Stra6l	G	T	4: 45,885,347	G605V	probably benign	Het
Syne2	A	G	12: 76,008,873	I4170V	probably benign	Het
Tgm7	T	A	2: 121,093,660	I594F	probably damaging	Het
Tle2	T	C	10: 81,587,996	L648P	probably damaging	Het
Tmprss2	G	T	16: 97,568,462	L371I	possibly damaging	Het
Ttn	T	C	2: 76,749,522	R23676G	probably damaging	Het
Tvp23b	T	C	11: 62,883,737	I69T	possibly damaging	Het
Vmn2r66	A	T	7: 85,006,818	I330N	probably damaging	Het
Vmn2r99	A	T	17: 19,394,181	D721V	probably damaging	Het
Zan	A	T	5: 137,446,846	V1717E	unknown	Het
Zmiz2	C	T	11: 6,403,190	H658Y	probably damaging	Het

Other mutations in Ptprs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Ptprs	APN	17	56458243	missense	probably damaging	0.99
IGL01388:Ptprs	APN	17	56421261	missense	probably damaging	1.00
IGL01568:Ptprs	APN	17	56413958	missense	probably damaging	1.00
IGL01781:Ptprs	APN	17	56435676	missense	probably damaging	1.00
IGL02499:Ptprs	APN	17	56437884	missense	probably damaging	1.00
IGL02576:Ptprs	APN	17	56414958	missense	probably damaging	1.00
IGL02736:Ptprs	APN	17	56458248	missense	possibly damaging	0.88
IGL02871:Ptprs	APN	17	56447443	missense	probably damaging	1.00
IGL02946:Ptprs	APN	17	56424032	missense	probably benign
IGL03061:Ptprs	APN	17	56418830	missense	probably damaging	0.96
IGL03347:Ptprs	APN	17	56435972	missense	probably benign	0.07
IGL03351:Ptprs	APN	17	56437943	missense	probably damaging	1.00
P0019:Ptprs	UTSW	17	56447474	splice site	probably benign
PIT4434001:Ptprs	UTSW	17	56454984	missense	probably null	0.02
PIT4520001:Ptprs	UTSW	17	56414980	missense	probably damaging	1.00
R0240:Ptprs	UTSW	17	56436087	splice site	probably null
R0240:Ptprs	UTSW	17	56436087	splice site	probably null
R0504:Ptprs	UTSW	17	56454220	missense	possibly damaging	0.60
R0518:Ptprs	UTSW	17	56419621	critical splice donor site	probably null
R0539:Ptprs	UTSW	17	56458255	missense	probably damaging	0.97
R0620:Ptprs	UTSW	17	56429103	missense	possibly damaging	0.93
R0683:Ptprs	UTSW	17	56414086	missense	probably damaging	1.00
R1147:Ptprs	UTSW	17	56423504	missense	probably damaging	1.00
R1147:Ptprs	UTSW	17	56423504	missense	probably damaging	1.00
R1474:Ptprs	UTSW	17	56424128	missense	probably damaging	0.98
R1502:Ptprs	UTSW	17	56437992	missense	probably benign	0.00
R1817:Ptprs	UTSW	17	56419527	missense	probably damaging	1.00
R1844:Ptprs	UTSW	17	56434510	missense	probably damaging	1.00
R2077:Ptprs	UTSW	17	56434990	missense	probably null	0.26
R2086:Ptprs	UTSW	17	56454984	missense	probably null	0.02
R2149:Ptprs	UTSW	17	56417706	missense	probably damaging	1.00
R3618:Ptprs	UTSW	17	56428965	missense	probably benign	0.25
R3722:Ptprs	UTSW	17	56417485	missense	probably damaging	1.00
R3771:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R3772:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R3773:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R4032:Ptprs	UTSW	17	56413386	missense	probably damaging	1.00
R4326:Ptprs	UTSW	17	56447468	missense	possibly damaging	0.83
R4327:Ptprs	UTSW	17	56447468	missense	possibly damaging	0.83
R4480:Ptprs	UTSW	17	56426404	missense	possibly damaging	0.79
R4505:Ptprs	UTSW	17	56451678	missense	possibly damaging	0.57
R4507:Ptprs	UTSW	17	56419014	missense	probably damaging	1.00
R4588:Ptprs	UTSW	17	56425534	missense	probably damaging	1.00
R4662:Ptprs	UTSW	17	56417666	missense	probably damaging	1.00
R4708:Ptprs	UTSW	17	56428067	missense	probably damaging	1.00
R5016:Ptprs	UTSW	17	56419070	missense	probably damaging	1.00
R5416:Ptprs	UTSW	17	56435724	missense	probably damaging	1.00
R5447:Ptprs	UTSW	17	56429128	missense	possibly damaging	0.50
R6041:Ptprs	UTSW	17	56419080	missense	probably benign	0.00
R6329:Ptprs	UTSW	17	56417427	nonsense	probably null
R6377:Ptprs	UTSW	17	56418935	missense	probably damaging	1.00
R6605:Ptprs	UTSW	17	56422195	missense	probably damaging	1.00
R6749:Ptprs	UTSW	17	56437884	missense	probably damaging	1.00
R7113:Ptprs	UTSW	17	56451697	missense	probably benign	0.40
R7114:Ptprs	UTSW	17	56451697	missense	probably benign	0.40
R7133:Ptprs	UTSW	17	56417429	missense	probably damaging	1.00
R7220:Ptprs	UTSW	17	56418988	missense	probably benign	0.29
R7423:Ptprs	UTSW	17	56414793	missense	probably damaging	1.00
R7440:Ptprs	UTSW	17	56424256	missense	possibly damaging	0.75
R7457:Ptprs	UTSW	17	56419502	missense	probably damaging	0.99
R7574:Ptprs	UTSW	17	56423538	missense	probably benign	0.00
R7851:Ptprs	UTSW	17	56425482	missense	probably benign
R7903:Ptprs	UTSW	17	56424960	nonsense	probably null
R8013:Ptprs	UTSW	17	56435994	missense	probably damaging	1.00
R8014:Ptprs	UTSW	17	56435994	missense	probably damaging	1.00
R8094:Ptprs	UTSW	17	56428947	missense	probably benign	0.01
R8112:Ptprs	UTSW	17	56434532	nonsense	probably null
R8181:Ptprs	UTSW	17	56429064	missense	probably damaging	1.00
R8682:Ptprs	UTSW	17	56435849	missense	probably damaging	0.98
R8875:Ptprs	UTSW	17	56435946	missense	probably damaging	1.00
R8911:Ptprs	UTSW	17	56423320	missense	probably benign	0.07
R8970:Ptprs	UTSW	17	56423353	missense	possibly damaging	0.94
R9117:Ptprs	UTSW	17	56435853	missense	possibly damaging	0.84
R9297:Ptprs	UTSW	17	56458257	missense	probably damaging	0.96
RF014:Ptprs	UTSW	17	56416935	missense	probably damaging	1.00
X0028:Ptprs	UTSW	17	56437831	missense	probably damaging	1.00
Z1176:Ptprs	UTSW	17	56417050	missense	possibly damaging	0.82
Z1176:Ptprs	UTSW	17	56422211	nonsense	probably null
Z1176:Ptprs	UTSW	17	56434468	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- CATTCCAATGACCCCTTGGATGG -3'
(R):5'- TTAGTCCACAGGATGCTGGG -3'

Sequencing Primer
(F):5'- TCGGGACTGCACAGGACAG -3'
(R):5'- TCCAGGAGTGGCAACCTCTTG -3'

Posted On

2020-10-20