Incidental Mutation 'R8511:Dmbt1'
ID 655874
Institutional Source Beutler Lab
Gene Symbol Dmbt1
Ensembl Gene ENSMUSG00000047517
Gene Name deleted in malignant brain tumors 1
Synonyms CRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock # R8511 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 131032053-131121630 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 131102012 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 1275 (N1275Y)
Ref Sequence ENSEMBL: ENSMUSP00000146685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000084509
AA Change: N1264Y
SMART Domains Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: N1264Y

DomainStartEndE-ValueType
SR 37 137 5.54e-59 SMART
SR 186 286 3.6e-58 SMART
SR 324 424 1.21e-59 SMART
SR 463 563 2.97e-59 SMART
SR 602 702 3.36e-58 SMART
SR 741 841 5.17e-59 SMART
low complexity region 848 879 N/A INTRINSIC
CUB 884 993 4.22e-41 SMART
CUB 1000 1109 7.35e-41 SMART
CUB 1126 1235 3.73e-42 SMART
CUB 1242 1351 2.02e-38 SMART
SR 1371 1471 3.92e-59 SMART
low complexity region 1476 1488 N/A INTRINSIC
CUB 1494 1603 6.7e-44 SMART
ZP 1612 1860 8.11e-74 SMART
transmembrane domain 1906 1928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208311
AA Change: N1275Y
Predicted Effect probably damaging
Transcript: ENSMUST00000213064
AA Change: N1101Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930512M02Rik T C 11: 11,590,056 H186R unknown Het
4931409K22Rik T A 5: 24,545,908 H559L possibly damaging Het
6430548M08Rik A G 8: 120,152,562 N233S probably benign Het
Acan A G 7: 79,097,935 D818G possibly damaging Het
Adam22 G A 5: 8,134,558 T478I probably damaging Het
Agmo T A 12: 37,244,397 *115R probably null Het
Ahnak A G 19: 9,012,355 K3668E unknown Het
Aldh6a1 G A 12: 84,433,971 T430I possibly damaging Het
Ankrd11 T C 8: 122,899,729 D17G Het
Apol10b C G 15: 77,585,010 E322D probably benign Het
Apol10b T C 15: 77,585,011 E322G probably benign Het
Apol8 C T 15: 77,750,073 G101E probably benign Het
Arhgef26 A T 3: 62,428,929 M630L probably damaging Het
Aspm T C 1: 139,457,308 L230P probably damaging Het
Atg101 T C 15: 101,290,622 S203P probably damaging Het
Baz2b T A 2: 59,901,814 T1996S probably benign Het
Brwd1 A T 16: 96,058,738 M350K probably damaging Het
Cad A G 5: 31,075,821 K1869R probably benign Het
Caskin1 A T 17: 24,505,936 I1233F probably benign Het
Ckap5 T A 2: 91,615,147 L1770I possibly damaging Het
Clip1 T C 5: 123,653,906 N67S possibly damaging Het
Csmd2 A G 4: 128,368,899 N626S Het
Cuedc2 C A 19: 46,330,919 probably null Het
Dnm3 A G 1: 162,286,042 V483A possibly damaging Het
Dock9 A T 14: 121,627,389 H718Q probably benign Het
Dock9 T C 14: 121,681,435 D50G probably damaging Het
Egfr T G 11: 16,896,949 I782S probably damaging Het
Elmod1 A T 9: 53,912,811 F298I probably damaging Het
Enthd1 T C 15: 80,474,227 Q364R probably damaging Het
Fat2 T A 11: 55,309,237 S1004C probably damaging Het
Fga A T 3: 83,031,757 K480* probably null Het
Fhod3 A G 18: 25,132,937 T1561A probably damaging Het
Foxg1 T A 12: 49,385,085 Y200* probably null Het
Foxj2 C T 6: 122,831,445 R115* probably null Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gm15922 A G 7: 3,739,348 L60P probably damaging Het
Gpsm2 A G 3: 108,682,083 S580P probably benign Het
Hectd1 A G 12: 51,787,871 S870P probably benign Het
Hic2 T A 16: 17,258,010 N234K possibly damaging Het
Ica1 A G 6: 8,754,726 F15L probably benign Het
Immp1l G A 2: 105,930,755 R3H probably benign Het
Jak3 T A 8: 71,685,550 Y882N probably damaging Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Luzp1 A G 4: 136,541,339 D291G probably damaging Het
Map3k19 C T 1: 127,847,418 E61K possibly damaging Het
Mical3 A G 6: 121,038,552 I175T possibly damaging Het
Nectin3 G A 16: 46,464,000 P107L probably damaging Het
Olfr975 A G 9: 39,950,159 V204A probably benign Het
Polr1a C A 6: 71,920,520 H207N probably benign Het
Prokr2 A G 2: 132,381,502 V40A probably benign Het
Prtg T C 9: 72,890,874 probably null Het
Ptprs G A 17: 56,447,440 T200I probably damaging Het
Ramp3 C T 11: 6,676,709 R139C probably benign Het
Scfd2 A G 5: 74,212,288 V642A possibly damaging Het
Scn11a T C 9: 119,789,915 K787R probably damaging Het
Slco3a1 A G 7: 74,303,242 V523A probably benign Het
Smo A G 6: 29,755,532 Y401C probably damaging Het
Spata5 A G 3: 37,436,748 M481V probably damaging Het
Stmn2 A G 3: 8,509,555 probably benign Het
Stra6l G T 4: 45,885,347 G605V probably benign Het
Syne2 A G 12: 76,008,873 I4170V probably benign Het
Tgm7 T A 2: 121,093,660 I594F probably damaging Het
Tle2 T C 10: 81,587,996 L648P probably damaging Het
Tmprss2 G T 16: 97,568,462 L371I possibly damaging Het
Ttn T C 2: 76,749,522 R23676G probably damaging Het
Tvp23b T C 11: 62,883,737 I69T possibly damaging Het
Vmn2r66 A T 7: 85,006,818 I330N probably damaging Het
Vmn2r99 A T 17: 19,394,181 D721V probably damaging Het
Zan A T 5: 137,446,846 V1717E unknown Het
Zmiz2 C T 11: 6,403,190 H658Y probably damaging Het
Other mutations in Dmbt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dmbt1 APN 7 131079540 intron probably benign
IGL00161:Dmbt1 APN 7 131109628 missense probably damaging 1.00
IGL00331:Dmbt1 APN 7 131099290 missense possibly damaging 0.46
IGL00769:Dmbt1 APN 7 131082500 missense probably damaging 0.99
IGL00792:Dmbt1 APN 7 131097607 missense possibly damaging 0.66
IGL00823:Dmbt1 APN 7 131058158 missense probably benign 0.26
IGL01072:Dmbt1 APN 7 131085368 splice site probably benign
IGL01317:Dmbt1 APN 7 131041191 missense probably damaging 1.00
IGL01335:Dmbt1 APN 7 131088767 missense possibly damaging 0.95
IGL01372:Dmbt1 APN 7 131103679 missense possibly damaging 0.90
IGL01511:Dmbt1 APN 7 131116728 missense possibly damaging 0.49
IGL01627:Dmbt1 APN 7 131081185 missense probably benign 0.14
IGL01890:Dmbt1 APN 7 131074419 intron probably benign
IGL02160:Dmbt1 APN 7 131082688 missense probably damaging 1.00
IGL02186:Dmbt1 APN 7 131093256 splice site probably benign
IGL02197:Dmbt1 APN 7 131085422 splice site probably benign
IGL02332:Dmbt1 APN 7 131066613 intron probably benign
IGL02427:Dmbt1 APN 7 131088085 splice site probably null
IGL02726:Dmbt1 APN 7 131074410 intron probably benign
IGL02967:Dmbt1 APN 7 131071189 missense possibly damaging 0.70
IGL03003:Dmbt1 APN 7 131082679 missense probably benign 0.05
IGL03089:Dmbt1 APN 7 131111049 missense probably damaging 0.99
lacunar UTSW 7 131097631 missense probably damaging 0.97
BB005:Dmbt1 UTSW 7 131037890 missense probably benign 0.16
BB015:Dmbt1 UTSW 7 131037890 missense probably benign 0.16
H8562:Dmbt1 UTSW 7 131112076 nonsense probably null
K3955:Dmbt1 UTSW 7 131119564 missense probably damaging 0.98
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0051:Dmbt1 UTSW 7 131119496 missense possibly damaging 0.79
R0257:Dmbt1 UTSW 7 131106393 missense probably damaging 1.00
R0388:Dmbt1 UTSW 7 131096049 splice site probably benign
R0427:Dmbt1 UTSW 7 131040902 nonsense probably null
R0478:Dmbt1 UTSW 7 131041187 missense possibly damaging 0.93
R0502:Dmbt1 UTSW 7 131097673 splice site probably null
R0538:Dmbt1 UTSW 7 131049901 splice site probably benign
R0626:Dmbt1 UTSW 7 131102081 missense probably damaging 0.97
R0631:Dmbt1 UTSW 7 131097653 missense possibly damaging 0.90
R0948:Dmbt1 UTSW 7 131093117 missense possibly damaging 0.95
R1169:Dmbt1 UTSW 7 131074524 critical splice donor site probably null
R1413:Dmbt1 UTSW 7 131050214 missense probably damaging 1.00
R1458:Dmbt1 UTSW 7 131044487 splice site probably benign
R1463:Dmbt1 UTSW 7 131109637 critical splice donor site probably null
R1509:Dmbt1 UTSW 7 131074331 intron probably benign
R1990:Dmbt1 UTSW 7 131058288 missense probably damaging 0.98
R2018:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2019:Dmbt1 UTSW 7 131110989 missense possibly damaging 0.93
R2042:Dmbt1 UTSW 7 131106359 missense probably damaging 0.99
R2056:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2057:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2058:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2059:Dmbt1 UTSW 7 131106170 missense possibly damaging 0.80
R2061:Dmbt1 UTSW 7 131099133 missense possibly damaging 0.66
R2092:Dmbt1 UTSW 7 131050018 missense probably damaging 1.00
R2102:Dmbt1 UTSW 7 131102032 missense probably damaging 0.97
R2155:Dmbt1 UTSW 7 131097575 missense possibly damaging 0.66
R2243:Dmbt1 UTSW 7 131046562 missense probably benign 0.03
R2256:Dmbt1 UTSW 7 131090494 missense probably benign 0.01
R2391:Dmbt1 UTSW 7 131106468 missense probably damaging 1.00
R2394:Dmbt1 UTSW 7 131094734 nonsense probably null
R3014:Dmbt1 UTSW 7 131032097 intron probably benign
R3155:Dmbt1 UTSW 7 131050157 nonsense probably null
R3176:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3276:Dmbt1 UTSW 7 131088071 missense probably benign 0.19
R3442:Dmbt1 UTSW 7 131106249 missense probably damaging 1.00
R3807:Dmbt1 UTSW 7 131112090 missense possibly damaging 0.77
R4060:Dmbt1 UTSW 7 131074202 intron probably benign
R4396:Dmbt1 UTSW 7 131116632 missense probably damaging 0.98
R4453:Dmbt1 UTSW 7 131040934 missense probably damaging 1.00
R5001:Dmbt1 UTSW 7 131050012 missense probably damaging 1.00
R5051:Dmbt1 UTSW 7 131094742 missense probably benign 0.01
R5156:Dmbt1 UTSW 7 131097670 critical splice donor site probably null
R5225:Dmbt1 UTSW 7 131094735 missense possibly damaging 0.84
R5281:Dmbt1 UTSW 7 131082619 missense probably damaging 1.00
R5308:Dmbt1 UTSW 7 131041021 missense probably damaging 1.00
R5447:Dmbt1 UTSW 7 131119511 missense probably damaging 0.99
R5467:Dmbt1 UTSW 7 131040993 missense probably damaging 1.00
R5497:Dmbt1 UTSW 7 131063403 intron probably benign
R5526:Dmbt1 UTSW 7 131041190 missense probably damaging 1.00
R5554:Dmbt1 UTSW 7 131099300 nonsense probably null
R5566:Dmbt1 UTSW 7 131106273 missense probably damaging 1.00
R5595:Dmbt1 UTSW 7 131054067 missense probably benign 0.17
R6154:Dmbt1 UTSW 7 131109641 splice site probably null
R6188:Dmbt1 UTSW 7 131097631 missense probably damaging 0.97
R6214:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6215:Dmbt1 UTSW 7 131066733 missense possibly damaging 0.95
R6391:Dmbt1 UTSW 7 131058254 missense probably damaging 1.00
R6397:Dmbt1 UTSW 7 131103578 missense possibly damaging 0.46
R6436:Dmbt1 UTSW 7 131116641 missense probably benign 0.01
R6603:Dmbt1 UTSW 7 131046510 splice site probably null
R6719:Dmbt1 UTSW 7 131119603 missense possibly damaging 0.83
R6781:Dmbt1 UTSW 7 131046561 missense probably benign 0.16
R7148:Dmbt1 UTSW 7 131066734 nonsense probably null
R7191:Dmbt1 UTSW 7 131044520 missense unknown
R7269:Dmbt1 UTSW 7 131066621 missense unknown
R7288:Dmbt1 UTSW 7 131083789 nonsense probably null
R7296:Dmbt1 UTSW 7 131112132 missense unknown
R7349:Dmbt1 UTSW 7 131041124 missense unknown
R7386:Dmbt1 UTSW 7 131112236 missense unknown
R7428:Dmbt1 UTSW 7 131108463 missense possibly damaging 0.53
R7481:Dmbt1 UTSW 7 131079511 critical splice acceptor site probably null
R7486:Dmbt1 UTSW 7 131066462 missense unknown
R7513:Dmbt1 UTSW 7 131090512 missense unknown
R7553:Dmbt1 UTSW 7 131104867 missense unknown
R7567:Dmbt1 UTSW 7 131061363 splice site probably null
R7584:Dmbt1 UTSW 7 131088751 nonsense probably null
R7736:Dmbt1 UTSW 7 131116896 missense unknown
R7758:Dmbt1 UTSW 7 131121197 missense unknown
R7928:Dmbt1 UTSW 7 131037890 missense probably benign 0.16
R8080:Dmbt1 UTSW 7 131088770 missense unknown
R8098:Dmbt1 UTSW 7 131108459 nonsense probably null
R8125:Dmbt1 UTSW 7 131099223 missense unknown
R8177:Dmbt1 UTSW 7 131106432 missense possibly damaging 0.46
R8350:Dmbt1 UTSW 7 131085417 critical splice donor site probably null
R8366:Dmbt1 UTSW 7 131066600 missense unknown
R8378:Dmbt1 UTSW 7 131106465 missense probably damaging 0.96
R8399:Dmbt1 UTSW 7 131082587 missense unknown
R8400:Dmbt1 UTSW 7 131082587 missense unknown
R8445:Dmbt1 UTSW 7 131090380 missense unknown
R8450:Dmbt1 UTSW 7 131085417 critical splice donor site probably null
R8688:Dmbt1 UTSW 7 131058254 missense unknown
R8850:Dmbt1 UTSW 7 131090404 missense unknown
R8852:Dmbt1 UTSW 7 131041123 missense unknown
R8871:Dmbt1 UTSW 7 131116868 missense unknown
R8943:Dmbt1 UTSW 7 131119643 missense possibly damaging 0.68
R8978:Dmbt1 UTSW 7 131037881 missense possibly damaging 0.53
R9004:Dmbt1 UTSW 7 131112069 missense unknown
R9020:Dmbt1 UTSW 7 131111058 missense possibly damaging 0.86
R9088:Dmbt1 UTSW 7 131116689 missense unknown
R9230:Dmbt1 UTSW 7 131037912 missense probably benign 0.01
R9304:Dmbt1 UTSW 7 131099125 missense unknown
R9377:Dmbt1 UTSW 7 131093102 missense unknown
R9428:Dmbt1 UTSW 7 131066478 missense unknown
X0024:Dmbt1 UTSW 7 131112248 nonsense probably null
X0062:Dmbt1 UTSW 7 131094851 missense possibly damaging 0.81
Z1176:Dmbt1 UTSW 7 131088812 missense unknown
Z1177:Dmbt1 UTSW 7 131082485 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCTAGCTCATCTCCTGTCTG -3'
(R):5'- TCCTGGGAGACTCTTATTCCAC -3'

Sequencing Primer
(F):5'- GTCTGTTTCCTCCTTTTGAATTTTGG -3'
(R):5'- AGACTCTTATTCCACATCAAAAATGG -3'
Posted On 2020-10-20