Mutagenetix > Incidental Mutation

Incidental Mutation 'R8517:Map7'

656213

Institutional Source

Beutler Lab

Gene Symbol

Map7

Ensembl Gene

ENSMUSG00000019996

Gene Name

microtubule-associated protein 7

Synonyms

E-MAP-115, mste, ste, Mtap7, mshi

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.363) question?

Stock #

R8517 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20148471-20281590 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20261835 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 251 (V251A)

Ref Sequence

ENSEMBL: ENSMUSP00000111963 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020173] [ENSMUST00000116259]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000020173

SMART Domains

Protein: ENSMUSP00000020173
Gene: ENSMUSG00000019996

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
low complexity region	55	85	N/A	INTRINSIC
coiled coil region	89	152	N/A	INTRINSIC
low complexity region	365	375	N/A	INTRINSIC
low complexity region	379	392	N/A	INTRINSIC
Pfam:MAP7	447	616	1.1e-59	PFAM
internal_repeat_1	623	658	5.23e-6	PROSPERO
internal_repeat_1	699	736	5.23e-6	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000116259
AA Change: V251A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000111963
Gene: ENSMUSG00000019996
AA Change: V251A

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
low complexity region	55	85	N/A	INTRINSIC
coiled coil region	89	152	N/A	INTRINSIC
low complexity region	365	375	N/A	INTRINSIC
low complexity region	379	392	N/A	INTRINSIC
Pfam:MAP7	453	611	4.7e-46	PFAM
internal_repeat_1	623	656	2.41e-5	PROSPERO
internal_repeat_1	699	734	2.41e-5	PROSPERO

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a microtubule-associated protein that is predominantly expressed in cells of epithelial origin. Microtubule-associated proteins are thought to be involved in microtubule dynamics, which is essential for cell polarization and differentiation. This protein has been shown to be able to stabilize microtubules, and may serve to modulate microtubule functions. Studies of the related mouse protein also suggested an essential role in microtubule function required for spermatogenesis. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
PHENOTYPE: Males homozygous for mutations in this marker are sterile with small, disorganized testes, small epidiymis and seminiferous tubules. They have deformed spermatid nuclei and a block in spermatogenesis. Aberrant microtubules are seen in elongating spermatids and sertoli cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,942,969	D131E	probably damaging	Het
Abca17	C	A	17: 24,317,233	V487F	probably benign	Het
Anapc5	T	C	5: 122,821,030	S41G	probably benign	Het
Aoc1	C	T	6: 48,906,710	Q507*	probably null	Het
Ccdc171	G	A	4: 83,743,061	R1136H	probably damaging	Het
Clspn	A	G	4: 126,566,219	D413G	probably benign	Het
Copz2	A	G	11: 96,853,483	K74E	possibly damaging	Het
Cpsf4l	C	A	11: 113,708,825	A45S	probably benign	Het
Cr2	T	C	1: 195,155,899	I710V	probably benign	Het
Csmd2	G	A	4: 128,552,686	R3348Q		Het
Dchs2	A	G	3: 83,271,112	I1157M	probably damaging	Het
Dcst1	A	G	3: 89,365,148	F3L	probably benign	Het
Dennd5b	A	C	6: 149,029,121	C743G	probably damaging	Het
Dnah6	T	C	6: 73,178,457	E725G	probably benign	Het
Dnajc3	G	T	14: 118,953,177	G51*	probably null	Het
Dyrk2	T	C	10: 118,861,021	T111A	probably benign	Het
F5	T	A	1: 164,176,253	F206I	probably damaging	Het
Fam217b	T	A	2: 178,420,772	S176R	probably benign	Het
Farsb	A	T	1: 78,463,296	L313*	probably null	Het
Fbxo18	A	G	2: 11,777,430		probably null	Het
Fgd4	G	A	16: 16,422,645	T740I	probably benign	Het
Gm14124	A	T	2: 150,268,123	E244D	probably benign	Het
Gprc6a	G	T	10: 51,631,241	A64D	probably benign	Het
Gtf3c1	A	T	7: 125,654,551	V1365E	probably damaging	Het
Hdc	C	G	2: 126,597,970		probably null	Het
Igkv5-39	T	G	6: 69,900,569	I68L	possibly damaging	Het
Kcnh2	A	T	5: 24,326,638	V425D	probably damaging	Het
Kcnj12	T	C	11: 61,069,373	S166P	probably benign	Het
Krtap16-1	A	T	11: 99,985,698	C293*	probably null	Het
Myo7b	G	T	18: 31,967,191	L1597M	possibly damaging	Het
Nmu	T	C	5: 76,345,479	E82G	possibly damaging	Het
Nup85	T	C	11: 115,564,564		probably null	Het
Nwd2	A	G	5: 63,791,582	N166D	probably damaging	Het
Olfr667	T	A	7: 104,916,474	H274L	possibly damaging	Het
Pbrm1	C	A	14: 31,067,782	D784E	probably benign	Het
Pcdhgb1	T	A	18: 37,682,064	M536K	possibly damaging	Het
Pml	T	A	9: 58,220,368	Q698L	possibly damaging	Het
Pon1	T	C	6: 5,171,769	Y294C	probably benign	Het
Rasal2	T	C	1: 157,146,279		probably null	Het
Rims1	T	A	1: 22,483,165	H484L	probably damaging	Het
Rpia	C	A	6: 70,766,646	V274L	possibly damaging	Het
Sart1	A	G	19: 5,383,197	L424P	probably damaging	Het
Scnm1	A	C	3: 95,132,823		probably null	Het
Slfn8	T	A	11: 83,004,142	M613L	possibly damaging	Het
Snph	A	G	2: 151,593,721	V429A	probably damaging	Het
Tarbp1	T	A	8: 126,444,195	D1022V	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Ttc8	A	G	12: 98,943,335	N100D	probably benign	Het
Zbtb49	T	A	5: 38,200,653	H752L	probably benign	Het
Zfp263	T	C	16: 3,746,896		probably null	Het
Zfp46	A	G	4: 136,291,147	T431A	probably benign	Het

Other mutations in Map7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01456:Map7	APN	10	20273804	missense	unknown
IGL03019:Map7	APN	10	20267355	missense	unknown
IGL03263:Map7	APN	10	20245322	nonsense	probably null
R0893:Map7	UTSW	10	20273883	splice site	probably null
R1172:Map7	UTSW	10	20245299	missense	probably damaging	1.00
R2097:Map7	UTSW	10	20246616	missense	probably damaging	1.00
R2239:Map7	UTSW	10	20278282	missense	unknown
R3760:Map7	UTSW	10	20276281	splice site	probably benign
R3980:Map7	UTSW	10	20267353	missense	unknown
R5009:Map7	UTSW	10	20261918	nonsense	probably null
R5397:Map7	UTSW	10	20273321	missense	unknown
R5422:Map7	UTSW	10	20266766	missense	probably damaging	0.99
R5501:Map7	UTSW	10	20276202	missense	unknown
R5664:Map7	UTSW	10	20267359	missense	unknown
R5773:Map7	UTSW	10	20246644	missense	probably benign	0.22
R6209:Map7	UTSW	10	20276280	splice site	probably null
R6438:Map7	UTSW	10	20267257	missense	unknown
R6446:Map7	UTSW	10	20278233	missense	unknown
R6919:Map7	UTSW	10	20171082	start gained	probably benign
R7327:Map7	UTSW	10	20233462	missense	unknown
R7440:Map7	UTSW	10	20261859	missense	probably damaging	1.00
R7596:Map7	UTSW	10	20278181	missense	unknown
R7958:Map7	UTSW	10	20229829	missense	unknown
R8524:Map7	UTSW	10	20266823	missense	probably benign	0.27
R8977:Map7	UTSW	10	20269590	critical splice donor site	probably null
R9164:Map7	UTSW	10	20246664	missense	probably benign	0.39
R9453:Map7	UTSW	10	20278235	missense	unknown
R9522:Map7	UTSW	10	20229896	missense	possibly damaging	0.81
R9574:Map7	UTSW	10	20278220	missense	unknown
X0022:Map7	UTSW	10	20269582	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CATACAAGGCTGAGACTGTCCAC -3'
(R):5'- GGCTTCTCCAGACACCACTTAC -3'

Sequencing Primer
(F):5'- AGGCTGAGACTGTCCACAATCG -3'
(R):5'- ACTTACCGCTAGTCCATGAATG -3'

Posted On

2020-10-20