Mutagenetix > Incidental Mutation

Incidental Mutation 'R8517:Slfn8'

656217

Institutional Source

Beutler Lab

Gene Symbol

Slfn8

Ensembl Gene

ENSMUSG00000035208

Gene Name

schlafen 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R8517 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83002158-83020810 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83004142 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 613 (M613L)

Ref Sequence

ENSEMBL: ENSMUSP00000040060 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]

AlphaFold

B1ARD8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038141
AA Change: M613L

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: M613L

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	1.6e-18	PFAM
Pfam:DUF2075	592	766	5.8e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092838
AA Change: M613L

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: M613L

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	205	341	1.4e-17	PFAM
Pfam:DUF2075	592	767	2.2e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108152

SMART Domains

Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	4.1e-19	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000130822
AA Change: M613L

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: M613L

Domain	Start	End	E-Value	Type
Pfam:AAA_4	205	343	3.7e-19	PFAM
SCOP:d1ly1a_	593	625	4e-3	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208
AA Change: M389L

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	27	163	1.8e-15	PFAM
SCOP:d1ly1a_	370	402	2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000215239

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,942,969	D131E	probably damaging	Het
Abca17	C	A	17: 24,317,233	V487F	probably benign	Het
Anapc5	T	C	5: 122,821,030	S41G	probably benign	Het
Aoc1	C	T	6: 48,906,710	Q507*	probably null	Het
Ccdc171	G	A	4: 83,743,061	R1136H	probably damaging	Het
Clspn	A	G	4: 126,566,219	D413G	probably benign	Het
Copz2	A	G	11: 96,853,483	K74E	possibly damaging	Het
Cpsf4l	C	A	11: 113,708,825	A45S	probably benign	Het
Cr2	T	C	1: 195,155,899	I710V	probably benign	Het
Csmd2	G	A	4: 128,552,686	R3348Q		Het
Dchs2	A	G	3: 83,271,112	I1157M	probably damaging	Het
Dcst1	A	G	3: 89,365,148	F3L	probably benign	Het
Dennd5b	A	C	6: 149,029,121	C743G	probably damaging	Het
Dnah6	T	C	6: 73,178,457	E725G	probably benign	Het
Dnajc3	G	T	14: 118,953,177	G51*	probably null	Het
Dyrk2	T	C	10: 118,861,021	T111A	probably benign	Het
F5	T	A	1: 164,176,253	F206I	probably damaging	Het
Fam217b	T	A	2: 178,420,772	S176R	probably benign	Het
Farsb	A	T	1: 78,463,296	L313*	probably null	Het
Fbxo18	A	G	2: 11,777,430		probably null	Het
Fgd4	G	A	16: 16,422,645	T740I	probably benign	Het
Gm14124	A	T	2: 150,268,123	E244D	probably benign	Het
Gprc6a	G	T	10: 51,631,241	A64D	probably benign	Het
Gtf3c1	A	T	7: 125,654,551	V1365E	probably damaging	Het
Hdc	C	G	2: 126,597,970		probably null	Het
Igkv5-39	T	G	6: 69,900,569	I68L	possibly damaging	Het
Kcnh2	A	T	5: 24,326,638	V425D	probably damaging	Het
Kcnj12	T	C	11: 61,069,373	S166P	probably benign	Het
Krtap16-1	A	T	11: 99,985,698	C293*	probably null	Het
Map7	T	C	10: 20,261,835	V251A	probably damaging	Het
Myo7b	G	T	18: 31,967,191	L1597M	possibly damaging	Het
Nmu	T	C	5: 76,345,479	E82G	possibly damaging	Het
Nup85	T	C	11: 115,564,564		probably null	Het
Nwd2	A	G	5: 63,791,582	N166D	probably damaging	Het
Olfr667	T	A	7: 104,916,474	H274L	possibly damaging	Het
Pbrm1	C	A	14: 31,067,782	D784E	probably benign	Het
Pcdhgb1	T	A	18: 37,682,064	M536K	possibly damaging	Het
Pml	T	A	9: 58,220,368	Q698L	possibly damaging	Het
Pon1	T	C	6: 5,171,769	Y294C	probably benign	Het
Rasal2	T	C	1: 157,146,279		probably null	Het
Rims1	T	A	1: 22,483,165	H484L	probably damaging	Het
Rpia	C	A	6: 70,766,646	V274L	possibly damaging	Het
Sart1	A	G	19: 5,383,197	L424P	probably damaging	Het
Scnm1	A	C	3: 95,132,823		probably null	Het
Snph	A	G	2: 151,593,721	V429A	probably damaging	Het
Tarbp1	T	A	8: 126,444,195	D1022V	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Ttc8	A	G	12: 98,943,335	N100D	probably benign	Het
Zbtb49	T	A	5: 38,200,653	H752L	probably benign	Het
Zfp263	T	C	16: 3,746,896		probably null	Het
Zfp46	A	G	4: 136,291,147	T431A	probably benign	Het

Other mutations in Slfn8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Slfn8	APN	11	83013484	missense	possibly damaging	0.75
IGL01418:Slfn8	APN	11	83004636	missense	probably damaging	1.00
IGL01620:Slfn8	APN	11	83004233	nonsense	probably null
IGL01875:Slfn8	APN	11	83004079	missense	probably benign	0.30
IGL01896:Slfn8	APN	11	83003696	missense	probably damaging	1.00
IGL01929:Slfn8	APN	11	83003405	nonsense	probably null
IGL02111:Slfn8	APN	11	83004498	missense	probably damaging	1.00
IGL02136:Slfn8	APN	11	83003465	nonsense	probably null
IGL02165:Slfn8	APN	11	83017196	missense	probably benign	0.00
IGL02645:Slfn8	APN	11	83003554	missense	possibly damaging	0.82
IGL02682:Slfn8	APN	11	83003691	missense	probably damaging	1.00
IGL02689:Slfn8	APN	11	83017108	missense	probably damaging	1.00
IGL02948:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03037:Slfn8	APN	11	83003252	missense	probably damaging	0.99
IGL03185:Slfn8	APN	11	83017507	missense	probably benign	0.01
IGL03243:Slfn8	APN	11	83003707	missense	probably damaging	1.00
IGL03286:Slfn8	APN	11	83013468	missense	probably damaging	0.99
seven_dwarfs	UTSW	11	83003334	missense	probably benign	0.09
vanwinkle	UTSW	11	83017393	missense	probably damaging	1.00
R0295:Slfn8	UTSW	11	83003343	nonsense	probably null
R0368:Slfn8	UTSW	11	83017132	missense	probably damaging	1.00
R0382:Slfn8	UTSW	11	83004556	missense	probably damaging	1.00
R0655:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R0894:Slfn8	UTSW	11	83003581	missense	probably benign	0.07
R1006:Slfn8	UTSW	11	83003511	missense	possibly damaging	0.69
R1181:Slfn8	UTSW	11	83016745	missense	probably benign	0.19
R1187:Slfn8	UTSW	11	83003488	missense	probably damaging	1.00
R1501:Slfn8	UTSW	11	83003180	missense	probably damaging	0.99
R1646:Slfn8	UTSW	11	83016886	missense	probably damaging	1.00
R1909:Slfn8	UTSW	11	83003621	nonsense	probably null
R2005:Slfn8	UTSW	11	83004150	missense	probably damaging	1.00
R2363:Slfn8	UTSW	11	83004094	missense	probably damaging	1.00
R3780:Slfn8	UTSW	11	83017454	missense	probably benign	0.13
R3890:Slfn8	UTSW	11	83004444	missense	possibly damaging	0.68
R3917:Slfn8	UTSW	11	83016993	nonsense	probably null
R4559:Slfn8	UTSW	11	83004744	missense	probably damaging	1.00
R4684:Slfn8	UTSW	11	83017506	missense	probably benign	0.10
R4767:Slfn8	UTSW	11	83003197	missense	possibly damaging	0.66
R4773:Slfn8	UTSW	11	83017393	missense	probably damaging	1.00
R4859:Slfn8	UTSW	11	83017714	start codon destroyed	probably null	0.99
R4916:Slfn8	UTSW	11	83016878	missense	probably damaging	1.00
R4939:Slfn8	UTSW	11	83003285	missense	probably benign	0.01
R5107:Slfn8	UTSW	11	83017150	missense	probably damaging	0.99
R5130:Slfn8	UTSW	11	83003821	missense	probably benign	0.35
R5165:Slfn8	UTSW	11	83017127	missense	probably damaging	0.99
R5238:Slfn8	UTSW	11	83013388	missense	probably damaging	0.96
R5282:Slfn8	UTSW	11	83017724	critical splice acceptor site	probably null
R5311:Slfn8	UTSW	11	83004084	missense	probably damaging	1.00
R5499:Slfn8	UTSW	11	83004216	missense	probably damaging	0.99
R5617:Slfn8	UTSW	11	83004721	missense	probably benign	0.01
R5782:Slfn8	UTSW	11	83017041	missense	probably damaging	0.98
R5823:Slfn8	UTSW	11	83016736	missense	probably benign	0.01
R5886:Slfn8	UTSW	11	83003334	missense	probably benign	0.09
R5933:Slfn8	UTSW	11	83003335	missense	probably benign	0.00
R6151:Slfn8	UTSW	11	83017321	missense	probably damaging	1.00
R6163:Slfn8	UTSW	11	83003864	makesense	probably null
R6191:Slfn8	UTSW	11	83016800	missense	possibly damaging	0.72
R6419:Slfn8	UTSW	11	83004055	splice site	probably null
R6925:Slfn8	UTSW	11	83013417	nonsense	probably null
R7065:Slfn8	UTSW	11	83016968	missense	probably benign	0.01
R7380:Slfn8	UTSW	11	83003740	missense	not run
R7414:Slfn8	UTSW	11	83016792	nonsense	probably null
R7819:Slfn8	UTSW	11	83004255	missense	probably damaging	1.00
R8425:Slfn8	UTSW	11	83004615	missense	possibly damaging	0.80
R8804:Slfn8	UTSW	11	83016813	missense	possibly damaging	0.94
R8814:Slfn8	UTSW	11	83016679	missense	possibly damaging	0.95
R9069:Slfn8	UTSW	11	83017076	missense	probably damaging	1.00
R9233:Slfn8	UTSW	11	83003596	missense	probably damaging	1.00
R9457:Slfn8	UTSW	11	83017706	missense	probably benign
R9678:Slfn8	UTSW	11	83016897	missense	probably damaging	1.00
R9708:Slfn8	UTSW	11	83003441	missense	probably benign	0.00
R9764:Slfn8	UTSW	11	83017012	missense	probably damaging	1.00
X0021:Slfn8	UTSW	11	83016928	missense	possibly damaging	0.69
Z1177:Slfn8	UTSW	11	83003533	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- TATGTCATAGTCCCAGCAACAC -3'
(R):5'- TGCAGGCCCTTGTGATTGTC -3'

Sequencing Primer
(F):5'- GCTATCTCAGATCATTTGACTGAC -3'
(R):5'- GTGATTGTCTTGCTCAACTTCAG -3'

Posted On

2020-10-20