Incidental Mutation 'R8517:Slfn8'
ID 656217
Institutional Source Beutler Lab
Gene Symbol Slfn8
Ensembl Gene ENSMUSG00000035208
Gene Name schlafen 8
Synonyms
MMRRC Submission 067849-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R8517 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 82892984-82911636 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 82894968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 613 (M613L)
Ref Sequence ENSEMBL: ENSMUSP00000040060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]
AlphaFold B1ARD8
Predicted Effect possibly damaging
Transcript: ENSMUST00000038141
AA Change: M613L

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: M613L

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 1.6e-18 PFAM
Pfam:DUF2075 592 766 5.8e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092838
AA Change: M613L

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: M613L

DomainStartEndE-ValueType
Pfam:AlbA_2 205 341 1.4e-17 PFAM
Pfam:DUF2075 592 767 2.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108152
SMART Domains Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 4.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130822
AA Change: M613L

PolyPhen 2 Score 0.683 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: M613L

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 3.7e-19 PFAM
SCOP:d1ly1a_ 593 625 4e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208
AA Change: M389L

DomainStartEndE-ValueType
Pfam:AlbA_2 27 163 1.8e-15 PFAM
SCOP:d1ly1a_ 370 402 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215239
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310002L09Rik A T 4: 73,861,206 (GRCm39) D131E probably damaging Het
Abca17 C A 17: 24,536,207 (GRCm39) V487F probably benign Het
Anapc5 T C 5: 122,959,093 (GRCm39) S41G probably benign Het
Aoc1 C T 6: 48,883,644 (GRCm39) Q507* probably null Het
Ccdc171 G A 4: 83,661,298 (GRCm39) R1136H probably damaging Het
Clspn A G 4: 126,460,012 (GRCm39) D413G probably benign Het
Copz2 A G 11: 96,744,309 (GRCm39) K74E possibly damaging Het
Cpsf4l C A 11: 113,599,651 (GRCm39) A45S probably benign Het
Cr2 T C 1: 194,838,207 (GRCm39) I710V probably benign Het
Csmd2 G A 4: 128,446,479 (GRCm39) R3348Q Het
Dchs2 A G 3: 83,178,419 (GRCm39) I1157M probably damaging Het
Dcst1 A G 3: 89,272,455 (GRCm39) F3L probably benign Het
Dennd5b A C 6: 148,930,619 (GRCm39) C743G probably damaging Het
Dnah6 T C 6: 73,155,440 (GRCm39) E725G probably benign Het
Dnajc3 G T 14: 119,190,589 (GRCm39) G51* probably null Het
Dyrk2 T C 10: 118,696,926 (GRCm39) T111A probably benign Het
F5 T A 1: 164,003,822 (GRCm39) F206I probably damaging Het
Fam217b T A 2: 178,062,565 (GRCm39) S176R probably benign Het
Farsb A T 1: 78,439,933 (GRCm39) L313* probably null Het
Fbh1 A G 2: 11,782,241 (GRCm39) probably null Het
Fgd4 G A 16: 16,240,509 (GRCm39) T740I probably benign Het
Gprc6a G T 10: 51,507,337 (GRCm39) A64D probably benign Het
Gtf3c1 A T 7: 125,253,723 (GRCm39) V1365E probably damaging Het
Hdc C G 2: 126,439,890 (GRCm39) probably null Het
Igkv5-39 T G 6: 69,877,553 (GRCm39) I68L possibly damaging Het
Kcnh2 A T 5: 24,531,636 (GRCm39) V425D probably damaging Het
Kcnj12 T C 11: 60,960,199 (GRCm39) S166P probably benign Het
Krtap16-1 A T 11: 99,876,524 (GRCm39) C293* probably null Het
Map7 T C 10: 20,137,581 (GRCm39) V251A probably damaging Het
Myo7b G T 18: 32,100,244 (GRCm39) L1597M possibly damaging Het
Nmu T C 5: 76,493,326 (GRCm39) E82G possibly damaging Het
Nup85 T C 11: 115,455,390 (GRCm39) probably null Het
Nwd2 A G 5: 63,948,925 (GRCm39) N166D probably damaging Het
Or52n2b T A 7: 104,565,681 (GRCm39) H274L possibly damaging Het
Pbrm1 C A 14: 30,789,739 (GRCm39) D784E probably benign Het
Pcdhgb1 T A 18: 37,815,117 (GRCm39) M536K possibly damaging Het
Pml T A 9: 58,127,651 (GRCm39) Q698L possibly damaging Het
Pon1 T C 6: 5,171,769 (GRCm39) Y294C probably benign Het
Rasal2 T C 1: 156,973,849 (GRCm39) probably null Het
Rims1 T A 1: 22,522,246 (GRCm39) H484L probably damaging Het
Rpia C A 6: 70,743,630 (GRCm39) V274L possibly damaging Het
Sart1 A G 19: 5,433,225 (GRCm39) L424P probably damaging Het
Scnm1 A C 3: 95,040,134 (GRCm39) probably null Het
Snph A G 2: 151,435,641 (GRCm39) V429A probably damaging Het
Tarbp1 T A 8: 127,170,934 (GRCm39) D1022V probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Ttc8 A G 12: 98,909,594 (GRCm39) N100D probably benign Het
Zbtb49 T A 5: 38,357,997 (GRCm39) H752L probably benign Het
Zfp1005 A T 2: 150,110,043 (GRCm39) E244D probably benign Het
Zfp263 T C 16: 3,564,760 (GRCm39) probably null Het
Zfp46 A G 4: 136,018,458 (GRCm39) T431A probably benign Het
Other mutations in Slfn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Slfn8 APN 11 82,904,310 (GRCm39) missense possibly damaging 0.75
IGL01418:Slfn8 APN 11 82,895,462 (GRCm39) missense probably damaging 1.00
IGL01620:Slfn8 APN 11 82,895,059 (GRCm39) nonsense probably null
IGL01875:Slfn8 APN 11 82,894,905 (GRCm39) missense probably benign 0.30
IGL01896:Slfn8 APN 11 82,894,522 (GRCm39) missense probably damaging 1.00
IGL01929:Slfn8 APN 11 82,894,231 (GRCm39) nonsense probably null
IGL02111:Slfn8 APN 11 82,895,324 (GRCm39) missense probably damaging 1.00
IGL02136:Slfn8 APN 11 82,894,291 (GRCm39) nonsense probably null
IGL02165:Slfn8 APN 11 82,908,022 (GRCm39) missense probably benign 0.00
IGL02645:Slfn8 APN 11 82,894,380 (GRCm39) missense possibly damaging 0.82
IGL02682:Slfn8 APN 11 82,894,517 (GRCm39) missense probably damaging 1.00
IGL02689:Slfn8 APN 11 82,907,934 (GRCm39) missense probably damaging 1.00
IGL02948:Slfn8 APN 11 82,894,078 (GRCm39) missense probably damaging 0.99
IGL03037:Slfn8 APN 11 82,894,078 (GRCm39) missense probably damaging 0.99
IGL03185:Slfn8 APN 11 82,908,333 (GRCm39) missense probably benign 0.01
IGL03243:Slfn8 APN 11 82,894,533 (GRCm39) missense probably damaging 1.00
IGL03286:Slfn8 APN 11 82,904,294 (GRCm39) missense probably damaging 0.99
seven_dwarfs UTSW 11 82,894,160 (GRCm39) missense probably benign 0.09
vanwinkle UTSW 11 82,908,219 (GRCm39) missense probably damaging 1.00
R0295:Slfn8 UTSW 11 82,894,169 (GRCm39) nonsense probably null
R0368:Slfn8 UTSW 11 82,907,958 (GRCm39) missense probably damaging 1.00
R0382:Slfn8 UTSW 11 82,895,382 (GRCm39) missense probably damaging 1.00
R0655:Slfn8 UTSW 11 82,894,647 (GRCm39) missense probably benign 0.35
R0894:Slfn8 UTSW 11 82,894,407 (GRCm39) missense probably benign 0.07
R1006:Slfn8 UTSW 11 82,894,337 (GRCm39) missense possibly damaging 0.69
R1181:Slfn8 UTSW 11 82,907,571 (GRCm39) missense probably benign 0.19
R1187:Slfn8 UTSW 11 82,894,314 (GRCm39) missense probably damaging 1.00
R1501:Slfn8 UTSW 11 82,894,006 (GRCm39) missense probably damaging 0.99
R1646:Slfn8 UTSW 11 82,907,712 (GRCm39) missense probably damaging 1.00
R1909:Slfn8 UTSW 11 82,894,447 (GRCm39) nonsense probably null
R2005:Slfn8 UTSW 11 82,894,976 (GRCm39) missense probably damaging 1.00
R2363:Slfn8 UTSW 11 82,894,920 (GRCm39) missense probably damaging 1.00
R3780:Slfn8 UTSW 11 82,908,280 (GRCm39) missense probably benign 0.13
R3890:Slfn8 UTSW 11 82,895,270 (GRCm39) missense possibly damaging 0.68
R3917:Slfn8 UTSW 11 82,907,819 (GRCm39) nonsense probably null
R4559:Slfn8 UTSW 11 82,895,570 (GRCm39) missense probably damaging 1.00
R4684:Slfn8 UTSW 11 82,908,332 (GRCm39) missense probably benign 0.10
R4767:Slfn8 UTSW 11 82,894,023 (GRCm39) missense possibly damaging 0.66
R4773:Slfn8 UTSW 11 82,908,219 (GRCm39) missense probably damaging 1.00
R4859:Slfn8 UTSW 11 82,908,540 (GRCm39) start codon destroyed probably null 0.99
R4916:Slfn8 UTSW 11 82,907,704 (GRCm39) missense probably damaging 1.00
R4939:Slfn8 UTSW 11 82,894,111 (GRCm39) missense probably benign 0.01
R5107:Slfn8 UTSW 11 82,907,976 (GRCm39) missense probably damaging 0.99
R5130:Slfn8 UTSW 11 82,894,647 (GRCm39) missense probably benign 0.35
R5165:Slfn8 UTSW 11 82,907,953 (GRCm39) missense probably damaging 0.99
R5238:Slfn8 UTSW 11 82,904,214 (GRCm39) missense probably damaging 0.96
R5282:Slfn8 UTSW 11 82,908,550 (GRCm39) critical splice acceptor site probably null
R5311:Slfn8 UTSW 11 82,894,910 (GRCm39) missense probably damaging 1.00
R5499:Slfn8 UTSW 11 82,895,042 (GRCm39) missense probably damaging 0.99
R5617:Slfn8 UTSW 11 82,895,547 (GRCm39) missense probably benign 0.01
R5782:Slfn8 UTSW 11 82,907,867 (GRCm39) missense probably damaging 0.98
R5823:Slfn8 UTSW 11 82,907,562 (GRCm39) missense probably benign 0.01
R5886:Slfn8 UTSW 11 82,894,160 (GRCm39) missense probably benign 0.09
R5933:Slfn8 UTSW 11 82,894,161 (GRCm39) missense probably benign 0.00
R6151:Slfn8 UTSW 11 82,908,147 (GRCm39) missense probably damaging 1.00
R6163:Slfn8 UTSW 11 82,894,690 (GRCm39) makesense probably null
R6191:Slfn8 UTSW 11 82,907,626 (GRCm39) missense possibly damaging 0.72
R6419:Slfn8 UTSW 11 82,894,881 (GRCm39) splice site probably null
R6925:Slfn8 UTSW 11 82,904,243 (GRCm39) nonsense probably null
R7065:Slfn8 UTSW 11 82,907,794 (GRCm39) missense probably benign 0.01
R7380:Slfn8 UTSW 11 82,894,566 (GRCm39) missense not run
R7414:Slfn8 UTSW 11 82,907,618 (GRCm39) nonsense probably null
R7819:Slfn8 UTSW 11 82,895,081 (GRCm39) missense probably damaging 1.00
R8425:Slfn8 UTSW 11 82,895,441 (GRCm39) missense possibly damaging 0.80
R8804:Slfn8 UTSW 11 82,907,639 (GRCm39) missense possibly damaging 0.94
R8814:Slfn8 UTSW 11 82,907,505 (GRCm39) missense possibly damaging 0.95
R9069:Slfn8 UTSW 11 82,907,902 (GRCm39) missense probably damaging 1.00
R9233:Slfn8 UTSW 11 82,894,422 (GRCm39) missense probably damaging 1.00
R9457:Slfn8 UTSW 11 82,908,532 (GRCm39) missense probably benign
R9678:Slfn8 UTSW 11 82,907,723 (GRCm39) missense probably damaging 1.00
R9708:Slfn8 UTSW 11 82,894,267 (GRCm39) missense probably benign 0.00
R9764:Slfn8 UTSW 11 82,907,838 (GRCm39) missense probably damaging 1.00
X0021:Slfn8 UTSW 11 82,907,754 (GRCm39) missense possibly damaging 0.69
Z1177:Slfn8 UTSW 11 82,894,359 (GRCm39) missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TATGTCATAGTCCCAGCAACAC -3'
(R):5'- TGCAGGCCCTTGTGATTGTC -3'

Sequencing Primer
(F):5'- GCTATCTCAGATCATTTGACTGAC -3'
(R):5'- GTGATTGTCTTGCTCAACTTCAG -3'
Posted On 2020-10-20