Mutagenetix > Incidental Mutation

Incidental Mutation 'R8517:Csmd2'

656196

Institutional Source

Beutler Lab

Gene Symbol

Csmd2

Ensembl Gene

ENSMUSG00000028804

Gene Name

CUB and Sushi multiple domains 2

Synonyms

MMRRC Submission

067849-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R8517 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

127987857-128567656 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 128552686 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 3348 (R3348Q)

Ref Sequence

ENSEMBL: ENSMUSP00000138958 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000184063]

AlphaFold

no structure available at present

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,942,969	D131E	probably damaging	Het
Abca17	C	A	17: 24,317,233	V487F	probably benign	Het
Anapc5	T	C	5: 122,821,030	S41G	probably benign	Het
Aoc1	C	T	6: 48,906,710	Q507*	probably null	Het
Ccdc171	G	A	4: 83,743,061	R1136H	probably damaging	Het
Clspn	A	G	4: 126,566,219	D413G	probably benign	Het
Copz2	A	G	11: 96,853,483	K74E	possibly damaging	Het
Cpsf4l	C	A	11: 113,708,825	A45S	probably benign	Het
Cr2	T	C	1: 195,155,899	I710V	probably benign	Het
Dchs2	A	G	3: 83,271,112	I1157M	probably damaging	Het
Dcst1	A	G	3: 89,365,148	F3L	probably benign	Het
Dennd5b	A	C	6: 149,029,121	C743G	probably damaging	Het
Dnah6	T	C	6: 73,178,457	E725G	probably benign	Het
Dnajc3	G	T	14: 118,953,177	G51*	probably null	Het
Dyrk2	T	C	10: 118,861,021	T111A	probably benign	Het
F5	T	A	1: 164,176,253	F206I	probably damaging	Het
Fam217b	T	A	2: 178,420,772	S176R	probably benign	Het
Farsb	A	T	1: 78,463,296	L313*	probably null	Het
Fbxo18	A	G	2: 11,777,430		probably null	Het
Fgd4	G	A	16: 16,422,645	T740I	probably benign	Het
Gm14124	A	T	2: 150,268,123	E244D	probably benign	Het
Gprc6a	G	T	10: 51,631,241	A64D	probably benign	Het
Gtf3c1	A	T	7: 125,654,551	V1365E	probably damaging	Het
Hdc	C	G	2: 126,597,970		probably null	Het
Igkv5-39	T	G	6: 69,900,569	I68L	possibly damaging	Het
Kcnh2	A	T	5: 24,326,638	V425D	probably damaging	Het
Kcnj12	T	C	11: 61,069,373	S166P	probably benign	Het
Krtap16-1	A	T	11: 99,985,698	C293*	probably null	Het
Map7	T	C	10: 20,261,835	V251A	probably damaging	Het
Myo7b	G	T	18: 31,967,191	L1597M	possibly damaging	Het
Nmu	T	C	5: 76,345,479	E82G	possibly damaging	Het
Nup85	T	C	11: 115,564,564		probably null	Het
Nwd2	A	G	5: 63,791,582	N166D	probably damaging	Het
Olfr667	T	A	7: 104,916,474	H274L	possibly damaging	Het
Pbrm1	C	A	14: 31,067,782	D784E	probably benign	Het
Pcdhgb1	T	A	18: 37,682,064	M536K	possibly damaging	Het
Pml	T	A	9: 58,220,368	Q698L	possibly damaging	Het
Pon1	T	C	6: 5,171,769	Y294C	probably benign	Het
Rasal2	T	C	1: 157,146,279		probably null	Het
Rims1	T	A	1: 22,483,165	H484L	probably damaging	Het
Rpia	C	A	6: 70,766,646	V274L	possibly damaging	Het
Sart1	A	G	19: 5,383,197	L424P	probably damaging	Het
Scnm1	A	C	3: 95,132,823		probably null	Het
Slfn8	T	A	11: 83,004,142	M613L	possibly damaging	Het
Snph	A	G	2: 151,593,721	V429A	probably damaging	Het
Tarbp1	T	A	8: 126,444,195	D1022V	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Ttc8	A	G	12: 98,943,335	N100D	probably benign	Het
Zbtb49	T	A	5: 38,200,653	H752L	probably benign	Het
Zfp263	T	C	16: 3,746,896		probably null	Het
Zfp46	A	G	4: 136,291,147	T431A	probably benign	Het

Other mutations in Csmd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Csmd2	APN	4	128483473	missense	probably benign	0.03
IGL01098:Csmd2	APN	4	128059052	missense	probably damaging	0.99
IGL01114:Csmd2	APN	4	128369130	missense	probably benign	0.04
IGL01364:Csmd2	APN	4	128414288	missense	probably benign	0.01
IGL01530:Csmd2	APN	4	128414301	missense	possibly damaging	0.66
IGL01582:Csmd2	APN	4	128563305	nonsense	probably null
IGL01670:Csmd2	APN	4	128513371	splice site	probably benign
IGL01707:Csmd2	APN	4	128383005	missense	possibly damaging	0.81
IGL01810:Csmd2	APN	4	128480845	splice site	probably benign
IGL01837:Csmd2	APN	4	128419570	missense	possibly damaging	0.92
IGL01924:Csmd2	APN	4	128559947	missense	unknown
IGL02013:Csmd2	APN	4	128321323	missense	possibly damaging	0.47
IGL02020:Csmd2	APN	4	128559879	missense	probably damaging	1.00
IGL02037:Csmd2	APN	4	128477470	splice site	probably benign
IGL02303:Csmd2	APN	4	128369008	missense	probably benign	0.01
IGL02317:Csmd2	APN	4	128463727	splice site	probably benign
IGL02322:Csmd2	APN	4	128463727	splice site	probably benign
IGL02338:Csmd2	APN	4	128395066	missense	possibly damaging	0.79
IGL02412:Csmd2	APN	4	128513372	splice site	probably benign
IGL02428:Csmd2	APN	4	128474816	missense	possibly damaging	0.82
IGL02491:Csmd2	APN	4	128534257	missense	probably benign
IGL02701:Csmd2	APN	4	128496141	missense	probably benign	0.17
IGL02801:Csmd2	APN	4	128552075	splice site	probably null
IGL02818:Csmd2	APN	4	128209728	missense	probably damaging	1.00
IGL02863:Csmd2	APN	4	128521884	missense	probably benign	0.00
IGL02876:Csmd2	APN	4	128321335	nonsense	probably null
IGL02977:Csmd2	APN	4	128493276	nonsense	probably null
IGL03006:Csmd2	APN	4	128480765	splice site	probably benign
IGL03032:Csmd2	APN	4	128519041	missense	probably benign	0.03
IGL03148:Csmd2	APN	4	128384269	missense	probably damaging	1.00
IGL03157:Csmd2	APN	4	128414299	nonsense	probably null
IGL03245:Csmd2	APN	4	128509122	missense	probably benign	0.12
IGL03376:Csmd2	APN	4	128517671	missense	probably benign	0.03
IGL03014:Csmd2	UTSW	4	128296429	missense	probably benign	0.01
R0109:Csmd2	UTSW	4	128544743	missense	probably benign	0.03
R0112:Csmd2	UTSW	4	128496029	missense	probably damaging	1.00
R0157:Csmd2	UTSW	4	128521911	missense	probably benign	0.02
R0390:Csmd2	UTSW	4	128133673	intron	probably benign
R0441:Csmd2	UTSW	4	128520230	missense	probably benign	0.00
R0519:Csmd2	UTSW	4	128487005	missense	possibly damaging	0.95
R0743:Csmd2	UTSW	4	128113676	missense	probably benign	0.00
R0746:Csmd2	UTSW	4	128414297	missense	probably damaging	1.00
R0973:Csmd2	UTSW	4	128496188	missense	possibly damaging	0.91
R1019:Csmd2	UTSW	4	128522014	missense	probably benign	0.00
R1476:Csmd2	UTSW	4	128487001	missense	probably benign	0.08
R1641:Csmd2	UTSW	4	128483395	missense	possibly damaging	0.68
R1709:Csmd2	UTSW	4	128496195	missense	probably damaging	0.96
R2866:Csmd2	UTSW	4	128414392	critical splice donor site	probably null
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2873:Csmd2	UTSW	4	128557718	missense	unknown
R2893:Csmd2	UTSW	4	128538993	splice site	probably null
R3796:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3797:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3798:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3914:Csmd2	UTSW	4	128321324	missense	probably benign	0.07
R4198:Csmd2	UTSW	4	128510924	missense	probably benign	0.07
R4489:Csmd2	UTSW	4	128381945	missense	possibly damaging	0.68
R4571:Csmd2	UTSW	4	128480095	splice site	probably null
R4581:Csmd2	UTSW	4	128369088	missense	probably benign	0.02
R4599:Csmd2	UTSW	4	127988128	missense	probably benign	0.35
R4649:Csmd2	UTSW	4	128546073	missense	probably benign
R4706:Csmd2	UTSW	4	128544751	missense	probably benign
R4776:Csmd2	UTSW	4	128442892	missense	probably benign	0.09
R4838:Csmd2	UTSW	4	128517749	missense	probably benign
R4900:Csmd2	UTSW	4	128452525	missense	probably benign	0.03
R4999:Csmd2	UTSW	4	128521930	missense	probably benign	0.00
R5024:Csmd2	UTSW	4	128321348	missense	possibly damaging	0.94
R5034:Csmd2	UTSW	4	128059108	missense	probably damaging	0.98
R5152:Csmd2	UTSW	4	128552035	missense	probably benign	0.27
R5172:Csmd2	UTSW	4	128477397	missense	probably benign	0.10
R5231:Csmd2	UTSW	4	128546049	missense	probably benign	0.00
R5279:Csmd2	UTSW	4	128456914	missense	probably benign	0.30
R5287:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5403:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5410:Csmd2	UTSW	4	128548819	missense	probably benign
R5551:Csmd2	UTSW	4	128510948	missense	possibly damaging	0.83
R5566:Csmd2	UTSW	4	128462889	critical splice donor site	probably null
R5826:Csmd2	UTSW	4	128519199	splice site	probably null
R5907:Csmd2	UTSW	4	128197385	missense	probably damaging	0.99
R5913:Csmd2	UTSW	4	128551988	missense	probably benign	0.01
R5970:Csmd2	UTSW	4	128546151	missense	probably benign	0.00
R5977:Csmd2	UTSW	4	128059034	missense	probably damaging	1.00
R6027:Csmd2	UTSW	4	128559946	missense	unknown
R6075:Csmd2	UTSW	4	128486865	missense	probably benign	0.15
R6129:Csmd2	UTSW	4	128493334	missense	possibly damaging	0.79
R6363:Csmd2	UTSW	4	128400379	missense	probably benign	0.00
R6366:Csmd2	UTSW	4	128483452	missense	probably benign	0.00
R6404:Csmd2	UTSW	4	128521950	missense	possibly damaging	0.90
R6437:Csmd2	UTSW	4	127988100	missense	probably benign	0.24
R6441:Csmd2	UTSW	4	128394964	missense	probably benign	0.03
R6643:Csmd2	UTSW	4	128372597	missense	probably benign	0.14
R6724:Csmd2	UTSW	4	128563371	missense	probably damaging	0.97
R6734:Csmd2	UTSW	4	128463813	missense	probably benign	0.00
R6750:Csmd2	UTSW	4	128197225	missense	possibly damaging	0.91
R6801:Csmd2	UTSW	4	128383950	missense	probably benign	0.11
R6842:Csmd2	UTSW	4	128509159	missense	possibly damaging	0.72
R6843:Csmd2	UTSW	4	128463794	missense	probably benign	0.27
R6868:Csmd2	UTSW	4	128442840	missense	probably benign
R6882:Csmd2	UTSW	4	128449269	missense	probably benign	0.01
R7019:Csmd2	UTSW	4	128369063	missense
R7028:Csmd2	UTSW	4	128277228	missense
R7096:Csmd2	UTSW	4	128462726	missense
R7122:Csmd2	UTSW	4	128449227	missense
R7125:Csmd2	UTSW	4	128496162	missense
R7197:Csmd2	UTSW	4	128511033	missense
R7234:Csmd2	UTSW	4	128456779	missense
R7299:Csmd2	UTSW	4	128528262	missense
R7301:Csmd2	UTSW	4	128528262	missense
R7319:Csmd2	UTSW	4	128393679	missense
R7331:Csmd2	UTSW	4	128564228	splice site	probably null
R7332:Csmd2	UTSW	4	128419567	missense
R7352:Csmd2	UTSW	4	128557636	missense
R7402:Csmd2	UTSW	4	128322095	missense
R7402:Csmd2	UTSW	4	128322096	missense
R7474:Csmd2	UTSW	4	128546127	missense
R7555:Csmd2	UTSW	4	128452458	missense
R7592:Csmd2	UTSW	4	128463798	missense
R7700:Csmd2	UTSW	4	128545756	splice site	probably null
R7714:Csmd2	UTSW	4	128382950	nonsense	probably null
R7734:Csmd2	UTSW	4	128552057	missense
R7735:Csmd2	UTSW	4	128456930	critical splice donor site	probably null
R7757:Csmd2	UTSW	4	128483456	missense
R7805:Csmd2	UTSW	4	128419573	missense
R7823:Csmd2	UTSW	4	128209905	missense
R7904:Csmd2	UTSW	4	128419553	missense
R7946:Csmd2	UTSW	4	128520265	missense
R7964:Csmd2	UTSW	4	128523510	missense
R7968:Csmd2	UTSW	4	128197325	missense
R8003:Csmd2	UTSW	4	128539187	nonsense	probably null
R8071:Csmd2	UTSW	4	128393538	missense
R8504:Csmd2	UTSW	4	128546690	missense
R8511:Csmd2	UTSW	4	128368899	missense
R8704:Csmd2	UTSW	4	128197354	missense
R8722:Csmd2	UTSW	4	128551950	unclassified	probably benign
R8729:Csmd2	UTSW	4	128462845	missense
R8801:Csmd2	UTSW	4	128563402	missense	probably damaging	0.97
R8803:Csmd2	UTSW	4	128546684	missense
R8839:Csmd2	UTSW	4	128442888	missense
R8867:Csmd2	UTSW	4	128557676	missense
R8913:Csmd2	UTSW	4	128523558	missense
R8928:Csmd2	UTSW	4	128475789	missense
R8974:Csmd2	UTSW	4	128552587	missense
R9001:Csmd2	UTSW	4	128414286	missense
R9132:Csmd2	UTSW	4	128549214	missense
R9245:Csmd2	UTSW	4	128306375	missense
R9249:Csmd2	UTSW	4	128419530	nonsense	probably null
R9254:Csmd2	UTSW	4	128197319	missense
R9265:Csmd2	UTSW	4	128400370	missense
R9407:Csmd2	UTSW	4	128548820	missense
R9432:Csmd2	UTSW	4	128277211	missense
R9559:Csmd2	UTSW	4	128544768	missense
R9673:Csmd2	UTSW	4	128414269	missense
R9735:Csmd2	UTSW	4	128509108	missense
R9749:Csmd2	UTSW	4	128496128	missense
R9803:Csmd2	UTSW	4	128369193	missense
Z1177:Csmd2	UTSW	4	128530797	missense

Predicted Primers

PCR Primer
(F):5'- GGCCCCTCAAATATGTCTGC -3'
(R):5'- TCAACATGAACTTGTGTGAGC -3'

Sequencing Primer
(F):5'- GCTGCATCTTCAAATCCCGGAC -3'
(R):5'- CAACATGAACTTGTGTGAGCAGTTC -3'

Posted On

2020-10-20