Mutagenetix > Incidental Mutations

Incidental Mutation 'R8481:Dpp9'

657547

Institutional Source

Beutler Lab

Gene Symbol

Dpp9

Ensembl Gene

ENSMUSG00000001229

Gene Name

dipeptidylpeptidase 9

Synonyms

DPRP2, 6430584G11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8481 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56186807-56218889 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 56194467 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 582 (D582Y)

Ref Sequence

ENSEMBL: ENSMUSP00000046604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038794]

AlphaFold

Q8BVG4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038794
AA Change: D582Y

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000046604
Gene: ENSMUSG00000001229
AA Change: D582Y

Domain	Start	End	E-Value	Type
low complexity region	122	133	N/A	INTRINSIC
Pfam:DPPIV_N	145	569	5.2e-109	PFAM
Pfam:Peptidase_S15	617	793	2.8e-10	PFAM
Pfam:Peptidase_S9	657	862	2.5e-57	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the S9B family in clan SC of the serine proteases. The protein has been shown to have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Although the activity of this protein is similar to that of dipeptidyl peptidase 4 (DPP4), it does not appear to be membrane bound. In general, dipeptidyl peptidases appear to be involved in the regulation of the activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. Several transcript variants of this gene have been described but not fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants display partial neonatal lethality and complete lethality at preweaning stages with defects suckling due to undeveveloped tongue muscle. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acss2	T	A	2: 155,556,461	Y380*	probably null	Het
Apob	T	A	12: 7,994,807		probably null	Het
Aste1	G	A	9: 105,396,990	R143Q	possibly damaging	Het
BC024139	T	C	15: 76,120,682	D598G	probably damaging	Het
Bpifb9a	T	C	2: 154,269,479	V551A	probably benign	Het
Ccdc88b	A	T	19: 6,854,532	L427Q	probably damaging	Het
Cept1	A	G	3: 106,505,253	V301A	probably benign	Het
Chuk	G	T	19: 44,096,239	H306Q	probably benign	Het
Cryzl1	C	A	16: 91,707,273	E69*	probably null	Het
Cul5	A	T	9: 53,646,823	D160E	probably benign	Het
Dlec1	G	A	9: 119,143,267		probably null	Het
Dnah12	A	G	14: 26,853,796	M2954V	probably benign	Het
Dnah5	T	A	15: 28,419,795	D3746E	probably benign	Het
Dnm1	A	G	2: 32,340,478	V108A	probably benign	Het
Evi2	T	A	11: 79,515,462		probably benign	Het
Got2	T	A	8: 95,888,524		probably benign	Het
Gria2	A	T	3: 80,801,691	H61Q	possibly damaging	Het
Hnrnpa2b1	C	T	6: 51,467,411	V8I	probably benign	Het
Impg2	A	G	16: 56,252,266	I354V	possibly damaging	Het
Letm2	T	C	8: 25,580,359	K421R	possibly damaging	Het
Lrp1	T	C	10: 127,568,910	D1974G	probably damaging	Het
Magi2	A	T	5: 20,389,154	E5D	possibly damaging	Het
Mprip	T	A	11: 59,758,156	Y895*	probably null	Het
Myo5c	T	C	9: 75,301,444	F1679S	probably damaging	Het
Neb	T	C	2: 52,224,585	K4221E	probably damaging	Het
Nek4	A	G	14: 30,964,034	Y308C	probably damaging	Het
Nrsn1	T	C	13: 25,253,615	N110S	probably damaging	Het
Olfr1286	T	A	2: 111,420,649	I101F	possibly damaging	Het
Olfr96	T	A	17: 37,225,404	I93K	probably damaging	Het
Padi2	A	G	4: 140,933,253	Q348R	probably benign	Het
Pdgfrb	C	T	18: 61,065,742	T324I	probably benign	Het
Pon3	C	T	6: 5,221,715	R305H	probably benign	Het
Prlhr	A	G	19: 60,467,687	V147A	possibly damaging	Het
Ptpn21	T	C	12: 98,688,894	T605A	probably benign	Het
Rabep1	T	C	11: 70,887,127	S162P	probably damaging	Het
Rgs7bp	A	G	13: 105,054,208	S3P	probably damaging	Het
Sec24d	T	A	3: 123,353,424	L677H	probably damaging	Het
Slc13a3	T	C	2: 165,434,038	R263G	probably damaging	Het
Slu7	C	A	11: 43,437,493	L45M	probably damaging	Het
Slu7	T	A	11: 43,437,494	L45Q	probably damaging	Het
Sp140	A	G	1: 85,641,791	D374G	probably damaging	Het
Sppl2b	TGTCACAGGT	TGT	10: 80,866,069		probably null	Het
Tex36	A	T	7: 133,587,460	S128T	probably damaging	Het
Tpbg	T	C	9: 85,844,085	S36P	unknown	Het
Tubgcp2	C	A	7: 140,033,675	D30Y	probably damaging	Het
Vmn1r19	T	C	6: 57,404,947	S162P	probably damaging	Het

Other mutations in Dpp9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00895:Dpp9	APN	17	56205240	missense	probably damaging	0.99
IGL00920:Dpp9	APN	17	56200599	missense	probably benign	0.01
IGL01568:Dpp9	APN	17	56191159	missense	probably benign
IGL01583:Dpp9	APN	17	56211666	missense	probably benign	0.00
IGL01613:Dpp9	APN	17	56190713	missense	probably benign
IGL03371:Dpp9	APN	17	56187377	missense	probably benign	0.00
R0100:Dpp9	UTSW	17	56205854	missense	possibly damaging	0.75
R0100:Dpp9	UTSW	17	56205854	missense	possibly damaging	0.75
R0418:Dpp9	UTSW	17	56194404	splice site	probably benign
R1163:Dpp9	UTSW	17	56199426	missense	possibly damaging	0.90
R1680:Dpp9	UTSW	17	56190103	missense	probably benign	0.00
R1709:Dpp9	UTSW	17	56194431	missense	probably benign
R1762:Dpp9	UTSW	17	56188362	missense	probably damaging	1.00
R1809:Dpp9	UTSW	17	56199038	missense	probably damaging	1.00
R1853:Dpp9	UTSW	17	56202885	missense	probably benign	0.00
R1854:Dpp9	UTSW	17	56202885	missense	probably benign	0.00
R2162:Dpp9	UTSW	17	56199113	missense	possibly damaging	0.81
R2205:Dpp9	UTSW	17	56199287	missense	possibly damaging	0.87
R2301:Dpp9	UTSW	17	56194973	missense	probably benign	0.00
R2520:Dpp9	UTSW	17	56206868	missense	probably damaging	1.00
R3831:Dpp9	UTSW	17	56199113	missense	possibly damaging	0.81
R3833:Dpp9	UTSW	17	56199113	missense	possibly damaging	0.81
R4364:Dpp9	UTSW	17	56187391	missense	possibly damaging	0.79
R4737:Dpp9	UTSW	17	56198970	critical splice donor site	probably null
R4740:Dpp9	UTSW	17	56198970	critical splice donor site	probably null
R4741:Dpp9	UTSW	17	56205286	missense	probably benign
R4798:Dpp9	UTSW	17	56191016	missense	probably damaging	0.96
R4806:Dpp9	UTSW	17	56190030	missense	probably damaging	1.00
R5375:Dpp9	UTSW	17	56189424	nonsense	probably null
R5709:Dpp9	UTSW	17	56189393	missense	probably benign
R5783:Dpp9	UTSW	17	56211655	missense	probably damaging	0.98
R6454:Dpp9	UTSW	17	56206808	missense	probably damaging	1.00
R6532:Dpp9	UTSW	17	56205854	missense	possibly damaging	0.75
R6894:Dpp9	UTSW	17	56188321	missense	probably damaging	1.00
R7398:Dpp9	UTSW	17	56189405	nonsense	probably null
R7494:Dpp9	UTSW	17	56200619	missense	probably damaging	1.00
R7495:Dpp9	UTSW	17	56195044	missense	probably benign
R7511:Dpp9	UTSW	17	56205611	missense	possibly damaging	0.52
R7556:Dpp9	UTSW	17	56190012	missense	possibly damaging	0.66
R8228:Dpp9	UTSW	17	56191129	missense	probably damaging	1.00
R8724:Dpp9	UTSW	17	56205867	missense	probably benign	0.03
R8798:Dpp9	UTSW	17	56199037	missense	probably damaging	1.00
R9209:Dpp9	UTSW	17	56205765	missense	probably damaging	1.00
X0065:Dpp9	UTSW	17	56195006	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CCTCTTTTGACCCGAGATGAC -3'
(R):5'- TGATGCCTGTCCATTGAGG -3'

Sequencing Primer
(F):5'- AGATGACTCTTCCCCAGGC -3'
(R):5'- TCCATTGAGGACGAAGCCTG -3'

Posted On

2021-01-18