Incidental Mutation 'R8481:Dpp9'
ID 657547
Institutional Source Beutler Lab
Gene Symbol Dpp9
Ensembl Gene ENSMUSG00000001229
Gene Name dipeptidylpeptidase 9
Synonyms DPRP2, 6430584G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8481 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 56186807-56218889 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 56194467 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 582 (D582Y)
Ref Sequence ENSEMBL: ENSMUSP00000046604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038794]
AlphaFold Q8BVG4
Predicted Effect possibly damaging
Transcript: ENSMUST00000038794
AA Change: D582Y

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046604
Gene: ENSMUSG00000001229
AA Change: D582Y

DomainStartEndE-ValueType
low complexity region 122 133 N/A INTRINSIC
Pfam:DPPIV_N 145 569 5.2e-109 PFAM
Pfam:Peptidase_S15 617 793 2.8e-10 PFAM
Pfam:Peptidase_S9 657 862 2.5e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the S9B family in clan SC of the serine proteases. The protein has been shown to have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Although the activity of this protein is similar to that of dipeptidyl peptidase 4 (DPP4), it does not appear to be membrane bound. In general, dipeptidyl peptidases appear to be involved in the regulation of the activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. Several transcript variants of this gene have been described but not fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants display partial neonatal lethality and complete lethality at preweaning stages with defects suckling due to undeveveloped tongue muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,556,461 Y380* probably null Het
Apob T A 12: 7,994,807 probably null Het
Aste1 G A 9: 105,396,990 R143Q possibly damaging Het
BC024139 T C 15: 76,120,682 D598G probably damaging Het
Bpifb9a T C 2: 154,269,479 V551A probably benign Het
Ccdc88b A T 19: 6,854,532 L427Q probably damaging Het
Cept1 A G 3: 106,505,253 V301A probably benign Het
Chuk G T 19: 44,096,239 H306Q probably benign Het
Cryzl1 C A 16: 91,707,273 E69* probably null Het
Cul5 A T 9: 53,646,823 D160E probably benign Het
Dlec1 G A 9: 119,143,267 probably null Het
Dnah12 A G 14: 26,853,796 M2954V probably benign Het
Dnah5 T A 15: 28,419,795 D3746E probably benign Het
Dnm1 A G 2: 32,340,478 V108A probably benign Het
Evi2 T A 11: 79,515,462 probably benign Het
Got2 T A 8: 95,888,524 probably benign Het
Gria2 A T 3: 80,801,691 H61Q possibly damaging Het
Hnrnpa2b1 C T 6: 51,467,411 V8I probably benign Het
Impg2 A G 16: 56,252,266 I354V possibly damaging Het
Letm2 T C 8: 25,580,359 K421R possibly damaging Het
Lrp1 T C 10: 127,568,910 D1974G probably damaging Het
Magi2 A T 5: 20,389,154 E5D possibly damaging Het
Mprip T A 11: 59,758,156 Y895* probably null Het
Myo5c T C 9: 75,301,444 F1679S probably damaging Het
Neb T C 2: 52,224,585 K4221E probably damaging Het
Nek4 A G 14: 30,964,034 Y308C probably damaging Het
Nrsn1 T C 13: 25,253,615 N110S probably damaging Het
Olfr1286 T A 2: 111,420,649 I101F possibly damaging Het
Olfr96 T A 17: 37,225,404 I93K probably damaging Het
Padi2 A G 4: 140,933,253 Q348R probably benign Het
Pdgfrb C T 18: 61,065,742 T324I probably benign Het
Pon3 C T 6: 5,221,715 R305H probably benign Het
Prlhr A G 19: 60,467,687 V147A possibly damaging Het
Ptpn21 T C 12: 98,688,894 T605A probably benign Het
Rabep1 T C 11: 70,887,127 S162P probably damaging Het
Rgs7bp A G 13: 105,054,208 S3P probably damaging Het
Sec24d T A 3: 123,353,424 L677H probably damaging Het
Slc13a3 T C 2: 165,434,038 R263G probably damaging Het
Slu7 C A 11: 43,437,493 L45M probably damaging Het
Slu7 T A 11: 43,437,494 L45Q probably damaging Het
Sp140 A G 1: 85,641,791 D374G probably damaging Het
Sppl2b TGTCACAGGT TGT 10: 80,866,069 probably null Het
Tex36 A T 7: 133,587,460 S128T probably damaging Het
Tpbg T C 9: 85,844,085 S36P unknown Het
Tubgcp2 C A 7: 140,033,675 D30Y probably damaging Het
Vmn1r19 T C 6: 57,404,947 S162P probably damaging Het
Other mutations in Dpp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Dpp9 APN 17 56205240 missense probably damaging 0.99
IGL00920:Dpp9 APN 17 56200599 missense probably benign 0.01
IGL01568:Dpp9 APN 17 56191159 missense probably benign
IGL01583:Dpp9 APN 17 56211666 missense probably benign 0.00
IGL01613:Dpp9 APN 17 56190713 missense probably benign
IGL03371:Dpp9 APN 17 56187377 missense probably benign 0.00
R0100:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R0100:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R0418:Dpp9 UTSW 17 56194404 splice site probably benign
R1163:Dpp9 UTSW 17 56199426 missense possibly damaging 0.90
R1680:Dpp9 UTSW 17 56190103 missense probably benign 0.00
R1709:Dpp9 UTSW 17 56194431 missense probably benign
R1762:Dpp9 UTSW 17 56188362 missense probably damaging 1.00
R1809:Dpp9 UTSW 17 56199038 missense probably damaging 1.00
R1853:Dpp9 UTSW 17 56202885 missense probably benign 0.00
R1854:Dpp9 UTSW 17 56202885 missense probably benign 0.00
R2162:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R2205:Dpp9 UTSW 17 56199287 missense possibly damaging 0.87
R2301:Dpp9 UTSW 17 56194973 missense probably benign 0.00
R2520:Dpp9 UTSW 17 56206868 missense probably damaging 1.00
R3831:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R3833:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R4364:Dpp9 UTSW 17 56187391 missense possibly damaging 0.79
R4737:Dpp9 UTSW 17 56198970 critical splice donor site probably null
R4740:Dpp9 UTSW 17 56198970 critical splice donor site probably null
R4741:Dpp9 UTSW 17 56205286 missense probably benign
R4798:Dpp9 UTSW 17 56191016 missense probably damaging 0.96
R4806:Dpp9 UTSW 17 56190030 missense probably damaging 1.00
R5375:Dpp9 UTSW 17 56189424 nonsense probably null
R5709:Dpp9 UTSW 17 56189393 missense probably benign
R5783:Dpp9 UTSW 17 56211655 missense probably damaging 0.98
R6454:Dpp9 UTSW 17 56206808 missense probably damaging 1.00
R6532:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R6894:Dpp9 UTSW 17 56188321 missense probably damaging 1.00
R7398:Dpp9 UTSW 17 56189405 nonsense probably null
R7494:Dpp9 UTSW 17 56200619 missense probably damaging 1.00
R7495:Dpp9 UTSW 17 56195044 missense probably benign
R7511:Dpp9 UTSW 17 56205611 missense possibly damaging 0.52
R7556:Dpp9 UTSW 17 56190012 missense possibly damaging 0.66
R8228:Dpp9 UTSW 17 56191129 missense probably damaging 1.00
R8724:Dpp9 UTSW 17 56205867 missense probably benign 0.03
R8798:Dpp9 UTSW 17 56199037 missense probably damaging 1.00
R9209:Dpp9 UTSW 17 56205765 missense probably damaging 1.00
X0065:Dpp9 UTSW 17 56195006 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCTCTTTTGACCCGAGATGAC -3'
(R):5'- TGATGCCTGTCCATTGAGG -3'

Sequencing Primer
(F):5'- AGATGACTCTTCCCCAGGC -3'
(R):5'- TCCATTGAGGACGAAGCCTG -3'
Posted On 2021-01-18